Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004606.1

Orthogroup ID

OG0004208

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 541

Gene Structure 541 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004606.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 370 bp

tctaggatgcattatgggagatcaagctgatggtgttcctgggatccaacatctggctcctgggtttggtcagaagactgccctaaagctcttgaaaaaacatggctcattggaaaatttactaaacatagcttcagtaagaactgtgggcagacagtatgcgcaagatgctcttacaaagtatgcggattatctacgaaggaactatgagattctttcccttagaagggatgtcaatgttcaacttaaagaggagtggcttgttccaagagacacaagcaatgattcaaaaactttgtcaaacttctttaaattcttggaagaaaccgagaaattcagtcatcaaagtggatctatttcaaatggctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0003887 GO:0004518 GO:0004527 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006139 GO:0006259 GO:0006260 GO:0006261 GO:0006281 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0008409 GO:0009058 GO:0009059 GO:0009987 GO:0016740 GO:0016772 GO:0016779 GO:0016787 GO:0016788 GO:0018130 GO:0019438 GO:0033554 GO:0034061 GO:0034641 GO:0034645 GO:0034654 GO:0043170 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044271 GO:0044424 GO:0044464 GO:0046483 GO:0050896 GO:0051716 GO:0071704 GO:0071897 GO:0090304 GO:0090305 GO:0140097 GO:1901360 GO:1901362 GO:1901576

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

5_3_exonuc 5_3_exonuc_N

Protein Analysis

122

Amino Acids

13.7

Weight (kDa)

8.75

Isoelectric Point (pI)

40.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004208)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G34380 AT1G34380 AT1G34380
fragaria_vesca	FvH4_2g12160 FvH4_2g12160 FvH4_2g12160 FvH4_2g12160 FvH4_2g12160 FvH4_2g12160
malus_domestica	MD05G1040800.v1.1 MD10G1046800.v1.1
prunus_persica	Prupe.8G055700_v2.0.a1 Prupe.8G055700_v2.0.a1 Prupe.8G055700_v2.0.a1 Prupe.8G055700_v2.0.a1 Prupe.8G055700_v2.0.a1
pyrus_communis	pycom05g03340 pycom05g03350 pycom10g03310
rosa_chinensis	RchiOBHm_Chr6g0272141
rosa_laevigata	RLG00000013698
rosa_multiflora	Rmu_co7960774.1_g000001 Rmu_sc0004606.1_g000001 Rmu_sc0008168.1_g000006 Rmu_sc0013301.1_g000010 Rmu_sc0027055.1_g000001
rosa_roxburghii	Rroxscaffold_7G00196560
rosa_rugosa	Rorug06G0066000
rosa_samantha	Rh6AG183200 Rh6BG183900 Rh6CG184500 Rh6DG176200
rosa_wichuraiana	Rw6G015770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	163
AccB7I	CCANNNNNTGG	1 cut(s)	53
AciI	CCGC	1 cut(s)	186
AclWI	GGATC	3 cut(s)	38, 51, 359
AcsI	RAATTY	3 cut(s)	116, 312, 333
AcuI	CTGAAG	1 cut(s)	118
AfiI	CCNNNNNNNGG	4 cut(s)	53, 66, 226, 227
AgsI	TTSAA	4 cut(s)	95, 243, 289, 361
AjnI	CCWGG	2 cut(s)	38, 59
AluBI	AGCT	3 cut(s)	27, 89, 132
AluI	AGCT	3 cut(s)	27, 89, 132
Alw26I	GTCTC	1 cut(s)	265
AlwI	GGATC	3 cut(s)	38, 51, 359
ApoI	RAATTY	3 cut(s)	116, 312, 333
ArsI	GACNNNNNNTTYG	2 cut(s)	282, 314
AspLEI	GCGC	1 cut(s)	164
BamHI	GGATCC	1 cut(s)	43
BbsI	GAAGAC	1 cut(s)	81
BccI	CCATC	1 cut(s)	24
BciT130I	CCWGG	2 cut(s)	40, 61
BcoDI	GTCTC	1 cut(s)	265
BfaI	CTAG	1 cut(s)	3
Bme1390I	CCNGG	2 cut(s)	40, 61
BmiI	GGNNCC	2 cut(s)	45, 58
BmrFI	CCNGG	2 cut(s)	40, 61
BmsI	GCATC	1 cut(s)	158
BpiI	GAAGAC	1 cut(s)	81
BsaJI	CCNNGG	2 cut(s)	39, 60
Bsc4I	CCNNNNNNNGG	4 cut(s)	53, 66, 226, 227
Bse3DI	GCAATG	1 cut(s)	287
BseBI	CCWGG	2 cut(s)	40, 61
BseDI	CCNNGG	2 cut(s)	39, 60
BseGI	GGATG	2 cut(s)	12, 236
BseLI	CCNNNNNNNGG	4 cut(s)	53, 66, 226, 227
BseMI	GCAATG	1 cut(s)	287
BseRI	GAGGAG	1 cut(s)	267
BslI	CCNNNNNNNGG	4 cut(s)	53, 66, 226, 227
BsmAI	GTCTC	1 cut(s)	265
Bsp143I	GATC	3 cut(s)	20, 43, 351
BspACI	CCGC	1 cut(s)	186
BspLI	GGNNCC	2 cut(s)	45, 58
BspPI	GGATC	3 cut(s)	38, 51, 359
BsrDI	GCAATG	1 cut(s)	287
BssECI	CCNNGG	2 cut(s)	39, 60
BssMI	GATC	3 cut(s)	20, 43, 351
Bst2UI	CCWGG	2 cut(s)	40, 61
Bst4CI	ACNGT	2 cut(s)	146, 157
BstDEI	CTNAG	1 cut(s)	222
BstF5I	GGATG	2 cut(s)	12, 236
BstHHI	GCGC	1 cut(s)	164
BstKTI	GATC	3 cut(s)	23, 46, 354
BstMAI	GTCTC	1 cut(s)	265
BstMBI	GATC	3 cut(s)	20, 43, 351
BstMWI	GCNNNNNNNGC	1 cut(s)	168
BstNI	CCWGG	2 cut(s)	40, 61
BstSCI	CCNGG	2 cut(s)	38, 59
BstV2I	GAAGAC	1 cut(s)	81
BstX2I	RGATCY	2 cut(s)	43, 351
BstYI	RGATCY	2 cut(s)	43, 351
BtsCI	GGATG	2 cut(s)	12, 236
CfoI	GCGC	1 cut(s)	164
CviAII	CATG	1 cut(s)	102
CviJI	RGCY	7 cut(s)	27, 57, 89, 106, 132, 260, 367
CviKI_1	RGCY	7 cut(s)	27, 57, 89, 106, 132, 260, 367
DdeI	CTNAG	1 cut(s)	222
DpnI	GATC	3 cut(s)	22, 45, 353
DpnII	GATC	3 cut(s)	20, 43, 351
DraI	TTTAAA	1 cut(s)	311
Eco57I	CTGAAG	1 cut(s)	118
EcoRII	CCWGG	2 cut(s)	38, 59
EcoT22I	ATGCAT	1 cut(s)	12
FaeI	CATG	1 cut(s)	105
FaiI	YATR	6 cut(s)	15, 103, 129, 160, 184, 208
FalI	AAGNNNNNCTT	2 cut(s)	157, 189
FatI	CATG	1 cut(s)	101
FokI	GGATG	2 cut(s)	19, 243
FspBI	CTAG	1 cut(s)	3
FspI	TGCGCA	1 cut(s)	163
GlaI	GCGC	1 cut(s)	163
HhaI	GCGC	1 cut(s)	164
Hin1II	CATG	1 cut(s)	105
Hin6I	GCGC	1 cut(s)	162
HinP1I	GCGC	1 cut(s)	162
HinfI	GANTC	2 cut(s)	212, 285
Hpy188I	TCNGA	1 cut(s)	73
Hpy188III	TCNNGA	1 cut(s)	92
HpyAV	CCTTC	2 cut(s)	193, 220
HpyCH4III	ACNGT	2 cut(s)	146, 157
HpyCH4V	TGCA	1 cut(s)	10
HpyF10VI	GCNNNNNNNGC	1 cut(s)	168
HpyF3I	CTNAG	1 cut(s)	222
Hsp92II	CATG	1 cut(s)	105
HspAI	GCGC	1 cut(s)	162
Kzo9I	GATC	3 cut(s)	20, 43, 351
LmnI	GCTCC	1 cut(s)	62
LpnPI	CCDG	5 cut(s)	25, 39, 46, 52, 73
LweI	GCATC	1 cut(s)	158
MaeI	CTAG	1 cut(s)	3
MalI	GATC	3 cut(s)	22, 45, 353
MboI	GATC	3 cut(s)	20, 43, 351
MboII	GAAGA	2 cut(s)	86, 333
MflI	RGATCY	2 cut(s)	43, 351
MluCI	AATT	3 cut(s)	116, 312, 333
MmeI	TCCRAC	1 cut(s)	71
MnlI	CCTC	1 cut(s)	245
Mph1103I	ATGCAT	1 cut(s)	12
MseI	TTAA	2 cut(s)	247, 310
MslI	CAYNNNNRTG	1 cut(s)	346
MspR9I	CCNGG	2 cut(s)	40, 61
MvaI	CCWGG	2 cut(s)	40, 61
MwoI	GCNNNNNNNGC	1 cut(s)	168
NdeII	GATC	3 cut(s)	20, 43, 351
NlaIII	CATG	1 cut(s)	105
NlaIV	GGNNCC	2 cut(s)	45, 58
NsbI	TGCGCA	1 cut(s)	163
NsiI	ATGCAT	1 cut(s)	12
PfeI	GAWTC	2 cut(s)	212, 285
PflMI	CCANNNNNTGG	1 cut(s)	53
Psp6I	CCWGG	2 cut(s)	38, 59
PspGI	CCWGG	2 cut(s)	38, 59
PspN4I	GGNNCC	2 cut(s)	45, 58
PsuI	RGATCY	2 cut(s)	43, 351
RseI	CAYNNNNRTG	1 cut(s)	346
SaqAI	TTAA	2 cut(s)	247, 310
Sau3AI	GATC	3 cut(s)	20, 43, 351
ScrFI	CCNGG	2 cut(s)	40, 61
SetI	ASST	3 cut(s)	29, 91, 134
SfaNI	GCATC	1 cut(s)	158
SmiMI	CAYNNNNRTG	1 cut(s)	346
Sse9I	AATT	3 cut(s)	116, 312, 333
SsiI	CCGC	1 cut(s)	186
SspMI	CTAG	1 cut(s)	3
StyD4I	CCNGG	2 cut(s)	38, 59
TaaI	ACNGT	2 cut(s)	146, 157
TasI	AATT	3 cut(s)	116, 312, 333
TfiI	GAWTC	2 cut(s)	212, 285
Tru1I	TTAA	2 cut(s)	247, 310
Tru9I	TTAA	2 cut(s)	247, 310
Van91I	CCANNNNNTGG	1 cut(s)	53
XapI	RAATTY	3 cut(s)	116, 312, 333
XspI	CTAG	1 cut(s)	3
Zsp2I	ATGCAT	1 cut(s)	12

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.