Rmu_co8003618.1_g000001

TITAN-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8003618.1
Physical Location & Seq
Forward (+)
1 .. 411
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8003618.1_g000001.1.cds

Sequence Viewer

Length: 202 bp
tggtaatgcaatgaatcacctggcaagtgccgaacatctgaagaatttgaagcgcttgtggaaaaatggtggtgtagcggattctgtagataaattcaagaaatcgtggggttttgagaggaggggagtggagtggacaatttgtaaagggaaatgggtttgttggggagaggaggatcagaggaagaagaagaaaatctaa

Protein Analysis

66

Amino Acids

7.71

Weight (kDa)

9.88

Isoelectric Point (pI)

13.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 78
AclWI GGATC 1 cut(s) 184
AcsI RAATTY 2 cut(s) 44, 93
AcuI CTGAAG 1 cut(s) 60
AfeI AGCGCT 1 cut(s) 54
AgsI TTSAA 2 cut(s) 50, 98
AjnI CCWGG 1 cut(s) 19
AlwI GGATC 1 cut(s) 184
Aor51HI AGCGCT 1 cut(s) 54
ApoI RAATTY 2 cut(s) 44, 93
AspLEI GCGC 1 cut(s) 55
AsuHPI GGTGA 1 cut(s) 9
BciT130I CCWGG 1 cut(s) 21
BfmI CTRYAG 1 cut(s) 85
BfoI RGCGCY 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 21
Bse3DI GCAATG 1 cut(s) 16
BseBI CCWGG 1 cut(s) 21
BseMI GCAATG 1 cut(s) 16
BseRI GAGGAG 2 cut(s) 134, 186
Bsp143I GATC 1 cut(s) 176
BspACI CCGC 1 cut(s) 78
BspPI GGATC 1 cut(s) 184
BsrDI GCAATG 1 cut(s) 16
BssMI GATC 1 cut(s) 176
Bst2UI CCWGG 1 cut(s) 21
BstH2I RGCGCY 1 cut(s) 56
BstHHI GCGC 1 cut(s) 55
BstKTI GATC 1 cut(s) 179
BstMBI GATC 1 cut(s) 176
BstNI CCWGG 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 19
BstSFI CTRYAG 1 cut(s) 85
CfoI GCGC 1 cut(s) 55
DpnI GATC 1 cut(s) 178
DpnII GATC 1 cut(s) 176
Eco47III AGCGCT 1 cut(s) 54
Eco57I CTGAAG 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 19
GlaI GCGC 1 cut(s) 54
HaeII RGCGCY 1 cut(s) 56
HhaI GCGC 1 cut(s) 55
Hin6I GCGC 1 cut(s) 53
HinP1I GCGC 1 cut(s) 53
HinfI GANTC 2 cut(s) 14, 81
HphI GGTGA 1 cut(s) 9
Hpy166II GTNNAC 1 cut(s) 136
Hpy188I TCNGA 2 cut(s) 40, 181
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 136
HpyCH4V TGCA 1 cut(s) 9
HspAI GCGC 1 cut(s) 53
Kzo9I GATC 1 cut(s) 176
LpnPI CCDG 2 cut(s) 6, 33
MalI GATC 1 cut(s) 178
MboI GATC 1 cut(s) 176
MboII GAAGA 3 cut(s) 53, 197, 200
MluCI AATT 3 cut(s) 44, 93, 139
MnlI CCTC 5 cut(s) 112, 115, 164, 167, 175
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
NdeII GATC 1 cut(s) 176
PfeI GAWTC 2 cut(s) 14, 81
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
Sau3AI GATC 1 cut(s) 176
ScrFI CCNGG 1 cut(s) 21
SetI ASST 1 cut(s) 22
SfcI CTRYAG 1 cut(s) 85
SgeI CNNG 6 cut(s) 32, 33, 37, 68, 110, 118
Sse9I AATT 3 cut(s) 44, 93, 139
SsiI CCGC 1 cut(s) 78
StyD4I CCNGG 1 cut(s) 19
TasI AATT 3 cut(s) 44, 93, 139
TfiI GAWTC 2 cut(s) 14, 81
TspDTI ATGAA 1 cut(s) 27
XapI RAATTY 2 cut(s) 44, 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.