Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8060918.1

Orthogroup ID

OG0006209

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 568

Gene Structure 568 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8060918.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 568 bp

cggaaagaagaagctcgttaaggggttcatcatcggcatccggattgattgagcttgatctgttatcagcaaatatatcgtcgccgtcgtcgtcatcgtcacggcaatttcagttgcaacaagcagccaggtcttccacgactcccatgtttcatgttcccgatcatcatcatcaaattcgtgttcctaatttcggcactaatttgatgaacactacgtctaatttatattttcaacaccccggaatgggaatgggaatgggaatgagtagttctttgccgccgagctttcctcaacaccagcaccaggaggttaactggggatttaggccattgatccctcatcataataatcatatagggaatagtgcttcaacttctacctcttcctcttcttttatgcaactgggaccagcatcctcctcctattttgcacgcccatttcaacttcaacatcatcatcttcatcatggtggtggtgctgggccgagcttagaattcagagttgttgatcctcctcggcggccccagtctggcatctggtttatgctacaagcctcacaaaatca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

188

Amino Acids

20.67

Weight (kDa)

11.07

Isoelectric Point (pI)

72.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006209)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G28080 AT1G28080 AT5G13250 AT5G13250
fragaria_vesca	FvH4_4g22950 FvH4_4g22950 FvH4_4g22950
malus_domestica	MD13G1127900.v1.1 MD16G1128300.v1.1
prunus_persica	Prupe.1G218100_v2.0.a1
pyrus_communis	pycom13g11080 pycom13g11090 pycom16g10880
rosa_chinensis	RchiOBHm_Chr4g0429231
rosa_laevigata	RLG00000007087
rosa_multiflora	Rmu_co8060918.1_g000001 Rmu_sc0000054.1_g000030 Rmu_sc0005338.1_g000002
rosa_roxburghii	Rroxscaffold_5G00370860
rosa_rugosa	Rorug04G0233800 Rorug04G0233900
rosa_samantha	Rh4AG289900 Rh4BG295700 Rh4CG311300 Rh4DG292700
rosa_wichuraiana	Rw4G025100 Rw5G007270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	40
AciI	CCGC	2 cut(s)	280, 522
AclWI	GGATC	2 cut(s)	330, 505
AcsI	RAATTY	2 cut(s)	176, 496
AfiI	CCNNNNNNNGG	5 cut(s)	193, 246, 247, 306, 532
AgsI	TTSAA	4 cut(s)	235, 374, 445, 451
AjnI	CCWGG	2 cut(s)	127, 305
AluBI	AGCT	4 cut(s)	14, 54, 287, 491
AluI	AGCT	4 cut(s)	14, 54, 287, 491
AlwI	GGATC	2 cut(s)	330, 505
Aor13HI	TCCGGA	1 cut(s)	40
AoxI	GGCC	3 cut(s)	328, 484, 523
ApeKI	GCWGC	1 cut(s)	124
ApoI	RAATTY	2 cut(s)	176, 496
ArsI	GACNNNNNNTTYG	2 cut(s)	64, 96
AspS9I	GGNCC	3 cut(s)	409, 484, 524
AsuC2I	CCSGG	1 cut(s)	242
AvaII	GGWCC	1 cut(s)	409
BbsI	GAAGAC	1 cut(s)	125
BbvI	GCAGC	1 cut(s)	136
BceAI	ACGGC	2 cut(s)	69, 118
BcgI	CGANNNNNNTGC	2 cut(s)	59, 93
BciT130I	CCWGG	2 cut(s)	129, 307
BcnI	CCSGG	1 cut(s)	242
BisI	GCNGC	3 cut(s)	125, 280, 523
BlsI	GCNGC	3 cut(s)	126, 281, 524
Bme1390I	CCNGG	3 cut(s)	129, 242, 307
Bme18I	GGWCC	1 cut(s)	409
BmgT120I	GGNCC	3 cut(s)	409, 484, 524
BmiI	GGNNCC	2 cut(s)	410, 526
BmrFI	CCNGG	3 cut(s)	129, 242, 307
BmrI	ACTGGG	3 cut(s)	327, 415, 522
BmsI	GCATC	3 cut(s)	46, 424, 545
BmuI	ACTGGG	3 cut(s)	327, 415, 522
BpiI	GAAGAC	1 cut(s)	125
BplI	GAGNNNNNCTC	2 cut(s)	276, 308
BpuMI	CCSGG	1 cut(s)	242
BsaBI	GATNNNNATC	1 cut(s)	167
BsaJI	CCNNGG	2 cut(s)	240, 517
BsaWI	WCCGGW	1 cut(s)	40
Bsc4I	CCNNNNNNNGG	5 cut(s)	193, 246, 247, 306, 532
Bse1I	ACTGG	3 cut(s)	322, 410, 528
Bse8I	GATNNNNATC	1 cut(s)	167
BseAI	TCCGGA	1 cut(s)	40
BseBI	CCWGG	2 cut(s)	129, 307
BseDI	CCNNGG	2 cut(s)	240, 517
BseGI	GGATG	2 cut(s)	37, 415
BseJI	GATNNNNATC	1 cut(s)	167
BseLI	CCNNNNNNNGG	5 cut(s)	193, 246, 247, 306, 532
BseNI	ACTGG	3 cut(s)	322, 410, 528
BseRI	GAGGAG	2 cut(s)	411, 506
BseXI	GCAGC	1 cut(s)	136
BseYI	CCCAGC	1 cut(s)	481
BshFI	GGCC	3 cut(s)	330, 486, 525
BsiSI	CCGG	2 cut(s)	41, 242
BslFI	GGGAC	1 cut(s)	422
BslI	CCNNNNNNNGG	5 cut(s)	193, 246, 247, 306, 532
BsmFI	GGGAC	1 cut(s)	422
BsnI	GGCC	3 cut(s)	330, 486, 525
Bsp13I	TCCGGA	1 cut(s)	40
Bsp143I	GATC	4 cut(s)	57, 162, 335, 510
BspACI	CCGC	2 cut(s)	280, 522
BspANI	GGCC	3 cut(s)	330, 486, 525
BspEI	TCCGGA	1 cut(s)	40
BspLI	GGNNCC	2 cut(s)	410, 526
BspPI	GGATC	2 cut(s)	330, 505
BsrI	ACTGG	3 cut(s)	322, 410, 528
BssECI	CCNNGG	2 cut(s)	240, 517
BssMI	GATC	4 cut(s)	57, 162, 335, 510
Bst2UI	CCWGG	2 cut(s)	129, 307
Bst6I	CTCTTC	2 cut(s)	390, 396
BstC8I	GCNNGC	1 cut(s)	435
BstDEI	CTNAG	1 cut(s)	492
BstF5I	GGATG	2 cut(s)	37, 415
BstKTI	GATC	4 cut(s)	60, 165, 338, 513
BstMBI	GATC	4 cut(s)	57, 162, 335, 510
BstNI	CCWGG	2 cut(s)	129, 307
BstSCI	CCNGG	3 cut(s)	127, 240, 305
BstV1I	GCAGC	1 cut(s)	136
BstV2I	GAAGAC	1 cut(s)	125
BsuRI	GGCC	3 cut(s)	330, 486, 525
BtsCI	GGATG	2 cut(s)	37, 415
Cac8I	GCNNGC	1 cut(s)	435
Cfr13I	GGNCC	3 cut(s)	409, 484, 524
CviAII	CATG	3 cut(s)	147, 154, 469
CviJI	RGCY	9 cut(s)	14, 54, 127, 287, 330, 486, 491, 525, 556
CviKI_1	RGCY	9 cut(s)	14, 54, 127, 287, 330, 486, 491, 525, 556
DdeI	CTNAG	1 cut(s)	492
DpnI	GATC	4 cut(s)	59, 164, 337, 512
DpnII	GATC	4 cut(s)	57, 162, 335, 510
Eam1104I	CTCTTC	2 cut(s)	390, 396
EarI	CTCTTC	2 cut(s)	390, 396
Eco47I	GGWCC	1 cut(s)	409
EcoRI	GAATTC	1 cut(s)	496
EcoRII	CCWGG	2 cut(s)	127, 305
FaeI	CATG	3 cut(s)	150, 157, 472
FaqI	GGGAC	1 cut(s)	422
FatI	CATG	3 cut(s)	146, 153, 468
Fnu4HI	GCNGC	3 cut(s)	125, 280, 523
FokI	GGATG	2 cut(s)	24, 402
Fsp4HI	GCNGC	3 cut(s)	125, 280, 523
GluI	GCNGC	3 cut(s)	125, 280, 523
GsaI	CCCAGC	1 cut(s)	485
HaeIII	GGCC	3 cut(s)	330, 486, 525
HapII	CCGG	2 cut(s)	41, 242
Hin1II	CATG	3 cut(s)	150, 157, 472
HincII	GTYRAC	1 cut(s)	315
HindII	GTYRAC	1 cut(s)	315
HinfI	GANTC	1 cut(s)	141
HpaI	GTTAAC	1 cut(s)	315
HpaII	CCGG	2 cut(s)	41, 242
Hpy166II	GTNNAC	1 cut(s)	315
Hpy188I	TCNGA	1 cut(s)	502
Hpy188III	TCNNGA	2 cut(s)	41, 160
Hpy8I	GTNNAC	1 cut(s)	315
Hpy99I	CGWCG	3 cut(s)	84, 90, 93
HpyCH4IV	ACGT	1 cut(s)	217
HpyCH4V	TGCA	3 cut(s)	117, 402, 433
HpyF3I	CTNAG	1 cut(s)	492
HpySE526I	ACGT	1 cut(s)	217
Hsp92II	CATG	3 cut(s)	150, 157, 472
Kpn2I	TCCGGA	1 cut(s)	40
KspAI	GTTAAC	1 cut(s)	315
Kzo9I	GATC	4 cut(s)	57, 162, 335, 510
Lsp1109I	GCAGC	1 cut(s)	136
LweI	GCATC	3 cut(s)	46, 424, 545
MaeII	ACGT	1 cut(s)	217
MaeIII	GTNAC	1 cut(s)	98
MalI	GATC	4 cut(s)	59, 164, 337, 512
MboI	GATC	4 cut(s)	57, 162, 335, 510
MboII	GAAGA	5 cut(s)	20, 125, 377, 383, 454
MluCI	AATT	6 cut(s)	106, 176, 189, 201, 222, 496
MlyI	GAGTC	1 cut(s)	135
MroI	TCCGGA	1 cut(s)	40
MseI	TTAA	2 cut(s)	19, 314
MslI	CAYNNNNRTG	2 cut(s)	470, 473
MspI	CCGG	2 cut(s)	41, 242
MspR9I	CCNGG	3 cut(s)	129, 242, 307
MvaI	CCWGG	2 cut(s)	129, 307
NciI	CCSGG	1 cut(s)	242
NdeII	GATC	4 cut(s)	57, 162, 335, 510
NlaIII	CATG	3 cut(s)	150, 157, 472
NlaIV	GGNNCC	2 cut(s)	410, 526
NmeAIII	GCCGAG	3 cut(s)	308, 498, 512
NmuCI	GTSAC	1 cut(s)	98
PcsI	WCGNNNNNNNCGW	3 cut(s)	85, 88, 94
PkrI	GCNGC	3 cut(s)	126, 281, 524
PleI	GAGTC	1 cut(s)	135
PpsI	GAGTC	1 cut(s)	135
Psp6I	CCWGG	2 cut(s)	127, 305
PspFI	CCCAGC	1 cut(s)	481
PspGI	CCWGG	2 cut(s)	127, 305
PspN4I	GGNNCC	2 cut(s)	410, 526
PspPI	GGNCC	3 cut(s)	409, 484, 524
RseI	CAYNNNNRTG	2 cut(s)	470, 473
SaqAI	TTAA	2 cut(s)	19, 314
SatI	GCNGC	3 cut(s)	125, 280, 523
Sau3AI	GATC	4 cut(s)	57, 162, 335, 510
Sau96I	GGNCC	3 cut(s)	409, 484, 524
SchI	GAGTC	1 cut(s)	135
ScrFI	CCNGG	3 cut(s)	129, 242, 307
SetI	ASST	8 cut(s)	16, 56, 133, 220, 289, 314, 385, 493
SfaNI	GCATC	3 cut(s)	46, 424, 545
SinI	GGWCC	1 cut(s)	409
SmiMI	CAYNNNNRTG	2 cut(s)	470, 473
Sse9I	AATT	6 cut(s)	106, 176, 189, 201, 222, 496
SsiI	CCGC	2 cut(s)	280, 522
StyD4I	CCNGG	3 cut(s)	127, 240, 305
TaiI	ACGT	1 cut(s)	220
TasI	AATT	6 cut(s)	106, 176, 189, 201, 222, 496
TauI	GCSGC	2 cut(s)	282, 525
Tru1I	TTAA	2 cut(s)	19, 314
Tru9I	TTAA	2 cut(s)	19, 314
TseFI	GTSAC	1 cut(s)	98
TseI	GCWGC	1 cut(s)	124
Tsp45I	GTSAC	1 cut(s)	98
TspDTI	ATGAA	4 cut(s)	17, 142, 223, 454
VpaK11BI	GGWCC	1 cut(s)	409
XapI	RAATTY	2 cut(s)	176, 496

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.