Rmu_co8070416.1_g000001

40S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8070416.1
Physical Location & Seq
Forward (+)
1 .. 451
451 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8070416.1_g000001.1.cds

Sequence Viewer

Length: 250 bp
gaatgatatcgatttgcttcatccaccagctgatctggagaagaggaagcacaagctcaagcggcttgtgcagaccccaaactcgttcttcatggatgtcaaatgccagggatgtttcaatataactactgtgttcagtcactcgcaaaccgttgtggtgtgtgggaactgccagacagtgttgtgccagcctactggtgggcgtgctaggctcaccgagggttgctccttcaggaggaaaggggactga

Protein Analysis

82

Amino Acids

9.19

Weight (kDa)

9.1

Isoelectric Point (pI)

36.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 62
AcuI CTGAAG 1 cut(s) 215
AfiI CCNNNNNNNGG 2 cut(s) 198, 235
AgsI TTSAA 1 cut(s) 119
AjnI CCWGG 1 cut(s) 106
AluBI AGCT 2 cut(s) 30, 56
AluI AGCT 2 cut(s) 30, 56
AsuHPI GGTGA 1 cut(s) 206
BciT130I CCWGG 1 cut(s) 108
BfaI CTAG 1 cut(s) 208
BisI GCNGC 1 cut(s) 63
BlsI GCNGC 1 cut(s) 64
Bme1390I CCNGG 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 108
BplI GAGNNNNNCTC 2 cut(s) 210, 242
BpmI CTGGAG 1 cut(s) 57
BpuEI CTTGAG 1 cut(s) 42
Bsa29I ATCGAT 1 cut(s) 10
BsaJI CCNNGG 2 cut(s) 107, 217
Bsc4I CCNNNNNNNGG 2 cut(s) 198, 235
Bse1I ACTGG 1 cut(s) 200
BseBI CCWGG 1 cut(s) 108
BseCI ATCGAT 1 cut(s) 10
BseDI CCNNGG 2 cut(s) 107, 217
BseGI GGATG 3 cut(s) 20, 101, 117
BseLI CCNNNNNNNGG 2 cut(s) 198, 235
BseNI ACTGG 1 cut(s) 200
BsgI GTGCAG 1 cut(s) 90
BshVI ATCGAT 1 cut(s) 10
BslI CCNNNNNNNGG 2 cut(s) 198, 235
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 1 cut(s) 62
BspDI ATCGAT 1 cut(s) 10
BsrI ACTGG 1 cut(s) 200
BssECI CCNNGG 2 cut(s) 107, 217
BssMI GATC 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 108
Bst4CI ACNGT 3 cut(s) 131, 152, 179
Bst6I CTCTTC 1 cut(s) 36
BstC8I GCNNGC 2 cut(s) 189, 205
BstENI CCTNNNNNAGG 1 cut(s) 233
BstF5I GGATG 3 cut(s) 20, 101, 117
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstMWI GCNNNNNNNGC 3 cut(s) 62, 68, 209
BstNI CCWGG 1 cut(s) 108
BstSCI CCNGG 1 cut(s) 106
BstXI CCANNNNNNTGG 1 cut(s) 195
Bsu15I ATCGAT 1 cut(s) 10
BsuTUI ATCGAT 1 cut(s) 10
BtsCI GGATG 3 cut(s) 20, 101, 117
BtsIMutI CAGTG 1 cut(s) 184
Cac8I GCNNGC 2 cut(s) 189, 205
ClaI ATCGAT 1 cut(s) 10
CviAII CATG 1 cut(s) 92
CviJI RGCY 5 cut(s) 30, 56, 65, 191, 212
CviKI_1 RGCY 5 cut(s) 30, 56, 65, 191, 212
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Eco32I GATATC 1 cut(s) 8
Eco57I CTGAAG 1 cut(s) 215
EcoNI CCTNNNNNAGG 1 cut(s) 233
EcoRII CCWGG 1 cut(s) 106
EcoRV GATATC 1 cut(s) 8
FaeI CATG 1 cut(s) 95
FaiI YATR 2 cut(s) 93, 123
FatI CATG 1 cut(s) 91
Fnu4HI GCNGC 1 cut(s) 63
FokI GGATG 3 cut(s) 7, 108, 124
Fsp4HI GCNGC 1 cut(s) 63
FspBI CTAG 1 cut(s) 208
GluI GCNGC 1 cut(s) 63
GsuI CTGGAG 1 cut(s) 57
Hin1II CATG 1 cut(s) 95
HphI GGTGA 1 cut(s) 206
Hpy188III TCNNGA 2 cut(s) 36, 233
HpyAV CCTTC 1 cut(s) 239
HpyCH4III ACNGT 3 cut(s) 131, 152, 179
HpyCH4V TGCA 1 cut(s) 71
HpyF10VI GCNNNNNNNGC 3 cut(s) 62, 68, 209
Hsp92II CATG 1 cut(s) 95
Kzo9I GATC 1 cut(s) 32
LmnI GCTCC 1 cut(s) 231
LpnPI CCDG 8 cut(s) 21, 40, 93, 120, 181, 186, 201, 218
MaeI CTAG 1 cut(s) 208
MaeIII GTNAC 1 cut(s) 138
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 2 cut(s) 53, 80
MnlI CCTC 3 cut(s) 37, 212, 229
MspA1I CMGCKG 1 cut(s) 30
MspR9I CCNGG 1 cut(s) 108
MvaI CCWGG 1 cut(s) 108
MwoI GCNNNNNNNGC 3 cut(s) 62, 68, 209
NdeII GATC 1 cut(s) 32
NlaIII CATG 1 cut(s) 95
NmuCI GTSAC 1 cut(s) 138
PkrI GCNGC 1 cut(s) 64
Psp6I CCWGG 1 cut(s) 106
PspGI CCWGG 1 cut(s) 106
PvuII CAGCTG 1 cut(s) 30
SatI GCNGC 1 cut(s) 63
Sau3AI GATC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 108
SetI ASST 2 cut(s) 32, 58
SmlI CTYRAG 1 cut(s) 57
SmoI CTYRAG 1 cut(s) 57
SsiI CCGC 1 cut(s) 62
SspMI CTAG 1 cut(s) 208
StyD4I CCNGG 1 cut(s) 106
TaaI ACNGT 3 cut(s) 131, 152, 179
TaqI TCGA 1 cut(s) 10
TauI GCSGC 1 cut(s) 65
TscAI CASTG 1 cut(s) 184
TseFI GTSAC 1 cut(s) 138
Tsp45I GTSAC 1 cut(s) 138
TspDTI ATGAA 2 cut(s) 9, 80
TspRI CASTG 1 cut(s) 184
XagI CCTNNNNNAGG 1 cut(s) 233
XcmI CCANNNNNNNNNTGG 1 cut(s) 195
XspI CTAG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.