Rmu_sc0001955.1_g000013

40S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001955.1
Physical Location & Seq
Forward (+)
60621 .. 61420
800 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001955.1_g000013.1.cds

Sequence Viewer

Length: 261 bp
atggttcttcagaatgatatcgatttgcttcatccaccagctgatctggagaagaggaagcacaagctcaagcggcttgtgcagaccccaaattctttcttcatggatgtcaaatgccagggatgtttcaatattactactgtgttcagtcactcgcaaaccgttgtggtgtgtgggaactgccagacagtgttgtgccagcctactggtgggcgtgccaggctcaccgagggttgctccttcaggaggaaaggggactga

Protein Analysis

86

Amino Acids

9.67

Weight (kDa)

9.1

Isoelectric Point (pI)

38.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 73
AcsI RAATTY 1 cut(s) 91
AcuI CTGAAG 1 cut(s) 226
AfiI CCNNNNNNNGG 2 cut(s) 209, 246
AgsI TTSAA 1 cut(s) 130
AjnI CCWGG 2 cut(s) 117, 218
AluBI AGCT 2 cut(s) 41, 67
AluI AGCT 2 cut(s) 41, 67
ApoI RAATTY 1 cut(s) 91
AsuHPI GGTGA 1 cut(s) 217
BciT130I CCWGG 2 cut(s) 119, 220
BisI GCNGC 1 cut(s) 74
BlsI GCNGC 1 cut(s) 75
Bme1390I CCNGG 2 cut(s) 119, 220
BmrFI CCNGG 2 cut(s) 119, 220
BplI GAGNNNNNCTC 2 cut(s) 221, 253
BpmI CTGGAG 1 cut(s) 68
BpuEI CTTGAG 1 cut(s) 53
Bsa29I ATCGAT 1 cut(s) 21
BsaJI CCNNGG 2 cut(s) 118, 228
Bsc4I CCNNNNNNNGG 2 cut(s) 209, 246
Bse1I ACTGG 1 cut(s) 211
BseBI CCWGG 2 cut(s) 119, 220
BseCI ATCGAT 1 cut(s) 21
BseDI CCNNGG 2 cut(s) 118, 228
BseGI GGATG 3 cut(s) 31, 112, 128
BseLI CCNNNNNNNGG 2 cut(s) 209, 246
BseNI ACTGG 1 cut(s) 211
BsgI GTGCAG 1 cut(s) 101
BshVI ATCGAT 1 cut(s) 21
BslI CCNNNNNNNGG 2 cut(s) 209, 246
Bsp143I GATC 1 cut(s) 43
BspACI CCGC 1 cut(s) 73
BspDI ATCGAT 1 cut(s) 21
BsrI ACTGG 1 cut(s) 211
BssECI CCNNGG 2 cut(s) 118, 228
BssMI GATC 1 cut(s) 43
Bst2UI CCWGG 2 cut(s) 119, 220
Bst4CI ACNGT 3 cut(s) 142, 163, 190
Bst6I CTCTTC 1 cut(s) 47
BstC8I GCNNGC 2 cut(s) 200, 216
BstENI CCTNNNNNAGG 1 cut(s) 244
BstF5I GGATG 3 cut(s) 31, 112, 128
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstMWI GCNNNNNNNGC 3 cut(s) 73, 79, 220
BstNI CCWGG 2 cut(s) 119, 220
BstSCI CCNGG 2 cut(s) 117, 218
BstXI CCANNNNNNTGG 1 cut(s) 206
Bsu15I ATCGAT 1 cut(s) 21
BsuTUI ATCGAT 1 cut(s) 21
BtsCI GGATG 3 cut(s) 31, 112, 128
BtsIMutI CAGTG 1 cut(s) 195
Cac8I GCNNGC 2 cut(s) 200, 216
ClaI ATCGAT 1 cut(s) 21
CviAII CATG 1 cut(s) 103
CviJI RGCY 5 cut(s) 41, 67, 76, 202, 223
CviKI_1 RGCY 5 cut(s) 41, 67, 76, 202, 223
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 47
EarI CTCTTC 1 cut(s) 47
Eco32I GATATC 1 cut(s) 19
Eco57I CTGAAG 1 cut(s) 226
EcoNI CCTNNNNNAGG 1 cut(s) 244
EcoRII CCWGG 2 cut(s) 117, 218
EcoRV GATATC 1 cut(s) 19
FaeI CATG 1 cut(s) 106
FaiI YATR 1 cut(s) 104
FatI CATG 1 cut(s) 102
Fnu4HI GCNGC 1 cut(s) 74
FokI GGATG 3 cut(s) 18, 119, 135
Fsp4HI GCNGC 1 cut(s) 74
GluI GCNGC 1 cut(s) 74
GsuI CTGGAG 1 cut(s) 68
Hin1II CATG 1 cut(s) 106
HphI GGTGA 1 cut(s) 217
Hpy188I TCNGA 1 cut(s) 12
Hpy188III TCNNGA 2 cut(s) 47, 244
HpyAV CCTTC 1 cut(s) 250
HpyCH4III ACNGT 3 cut(s) 142, 163, 190
HpyCH4V TGCA 1 cut(s) 82
HpyF10VI GCNNNNNNNGC 3 cut(s) 73, 79, 220
Hsp92II CATG 1 cut(s) 106
Kzo9I GATC 1 cut(s) 43
LmnI GCTCC 1 cut(s) 242
MaeIII GTNAC 1 cut(s) 149
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 2 cut(s) 64, 91
MluCI AATT 1 cut(s) 91
MnlI CCTC 3 cut(s) 48, 223, 240
MspA1I CMGCKG 1 cut(s) 41
MspR9I CCNGG 2 cut(s) 119, 220
MvaI CCWGG 2 cut(s) 119, 220
MwoI GCNNNNNNNGC 3 cut(s) 73, 79, 220
NdeII GATC 1 cut(s) 43
NlaIII CATG 1 cut(s) 106
NmuCI GTSAC 1 cut(s) 149
PkrI GCNGC 1 cut(s) 75
Psp6I CCWGG 2 cut(s) 117, 218
PspGI CCWGG 2 cut(s) 117, 218
PvuII CAGCTG 1 cut(s) 41
SatI GCNGC 1 cut(s) 74
Sau3AI GATC 1 cut(s) 43
ScrFI CCNGG 2 cut(s) 119, 220
SetI ASST 2 cut(s) 43, 69
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
Sse9I AATT 1 cut(s) 91
SsiI CCGC 1 cut(s) 73
SspI AATATT 1 cut(s) 133
StyD4I CCNGG 2 cut(s) 117, 218
TaaI ACNGT 3 cut(s) 142, 163, 190
TaqI TCGA 1 cut(s) 21
TasI AATT 1 cut(s) 91
TauI GCSGC 1 cut(s) 76
TscAI CASTG 1 cut(s) 195
TseFI GTSAC 1 cut(s) 149
Tsp45I GTSAC 1 cut(s) 149
TspDTI ATGAA 2 cut(s) 20, 91
TspRI CASTG 1 cut(s) 195
XagI CCTNNNNNAGG 1 cut(s) 244
XapI RAATTY 1 cut(s) 91
XcmI CCANNNNNNNNNTGG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.