Rmu_sc0033684.1_g000001

40S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033684.1
Physical Location & Seq
Forward (+)
1 .. 779
779 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033684.1_g000001.1.cds

Sequence Viewer

Length: 258 bp
gttcttcagaatgatatcgatttgcttcatccaccagctgatctggagaagaggaagcacaagctcaagcggcttgtgcagaccccaaattctttcttcatggatgtcaaatgccagggatgtttcaatattactactgtgttcagtcactcgcaaaccgttgtggtgtgtgggaactgccagacagtgttgtgccagcctactggtgggcgtgccaggctcaccgagggttgctccttcaggaggaaaggggactga

Protein Analysis

85

Amino Acids

9.53

Weight (kDa)

9.1

Isoelectric Point (pI)

39.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 70
AcsI RAATTY 1 cut(s) 88
AcuI CTGAAG 1 cut(s) 223
AfiI CCNNNNNNNGG 2 cut(s) 206, 243
AgsI TTSAA 1 cut(s) 127
AjnI CCWGG 2 cut(s) 114, 215
AluBI AGCT 2 cut(s) 38, 64
AluI AGCT 2 cut(s) 38, 64
ApoI RAATTY 1 cut(s) 88
AsuHPI GGTGA 1 cut(s) 214
BciT130I CCWGG 2 cut(s) 116, 217
BisI GCNGC 1 cut(s) 71
BlsI GCNGC 1 cut(s) 72
Bme1390I CCNGG 2 cut(s) 116, 217
BmrFI CCNGG 2 cut(s) 116, 217
BplI GAGNNNNNCTC 2 cut(s) 218, 250
BpmI CTGGAG 1 cut(s) 65
BpuEI CTTGAG 1 cut(s) 50
Bsa29I ATCGAT 1 cut(s) 18
BsaJI CCNNGG 2 cut(s) 115, 225
Bsc4I CCNNNNNNNGG 2 cut(s) 206, 243
Bse1I ACTGG 1 cut(s) 208
BseBI CCWGG 2 cut(s) 116, 217
BseCI ATCGAT 1 cut(s) 18
BseDI CCNNGG 2 cut(s) 115, 225
BseGI GGATG 3 cut(s) 28, 109, 125
BseLI CCNNNNNNNGG 2 cut(s) 206, 243
BseNI ACTGG 1 cut(s) 208
BsgI GTGCAG 1 cut(s) 98
BshVI ATCGAT 1 cut(s) 18
BslI CCNNNNNNNGG 2 cut(s) 206, 243
Bsp143I GATC 1 cut(s) 40
BspACI CCGC 1 cut(s) 70
BspDI ATCGAT 1 cut(s) 18
BsrI ACTGG 1 cut(s) 208
BssECI CCNNGG 2 cut(s) 115, 225
BssMI GATC 1 cut(s) 40
Bst2UI CCWGG 2 cut(s) 116, 217
Bst4CI ACNGT 3 cut(s) 139, 160, 187
Bst6I CTCTTC 1 cut(s) 44
BstC8I GCNNGC 2 cut(s) 197, 213
BstENI CCTNNNNNAGG 1 cut(s) 241
BstF5I GGATG 3 cut(s) 28, 109, 125
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 3 cut(s) 70, 76, 217
BstNI CCWGG 2 cut(s) 116, 217
BstSCI CCNGG 2 cut(s) 114, 215
BstXI CCANNNNNNTGG 1 cut(s) 203
Bsu15I ATCGAT 1 cut(s) 18
BsuTUI ATCGAT 1 cut(s) 18
BtsCI GGATG 3 cut(s) 28, 109, 125
BtsIMutI CAGTG 1 cut(s) 192
Cac8I GCNNGC 2 cut(s) 197, 213
ClaI ATCGAT 1 cut(s) 18
CviAII CATG 1 cut(s) 100
CviJI RGCY 5 cut(s) 38, 64, 73, 199, 220
CviKI_1 RGCY 5 cut(s) 38, 64, 73, 199, 220
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eam1104I CTCTTC 1 cut(s) 44
EarI CTCTTC 1 cut(s) 44
Eco32I GATATC 1 cut(s) 16
Eco57I CTGAAG 1 cut(s) 223
EcoNI CCTNNNNNAGG 1 cut(s) 241
EcoRII CCWGG 2 cut(s) 114, 215
EcoRV GATATC 1 cut(s) 16
FaeI CATG 1 cut(s) 103
FaiI YATR 1 cut(s) 101
FatI CATG 1 cut(s) 99
Fnu4HI GCNGC 1 cut(s) 71
FokI GGATG 3 cut(s) 15, 116, 132
Fsp4HI GCNGC 1 cut(s) 71
GluI GCNGC 1 cut(s) 71
GsuI CTGGAG 1 cut(s) 65
Hin1II CATG 1 cut(s) 103
HphI GGTGA 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 2 cut(s) 44, 241
HpyAV CCTTC 1 cut(s) 247
HpyCH4III ACNGT 3 cut(s) 139, 160, 187
HpyCH4V TGCA 1 cut(s) 79
HpyF10VI GCNNNNNNNGC 3 cut(s) 70, 76, 217
Hsp92II CATG 1 cut(s) 103
Kzo9I GATC 1 cut(s) 40
LmnI GCTCC 1 cut(s) 239
MaeIII GTNAC 1 cut(s) 146
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 2 cut(s) 61, 88
MluCI AATT 1 cut(s) 88
MnlI CCTC 3 cut(s) 45, 220, 237
MspA1I CMGCKG 1 cut(s) 38
MspR9I CCNGG 2 cut(s) 116, 217
MvaI CCWGG 2 cut(s) 116, 217
MwoI GCNNNNNNNGC 3 cut(s) 70, 76, 217
NdeII GATC 1 cut(s) 40
NlaIII CATG 1 cut(s) 103
NmuCI GTSAC 1 cut(s) 146
PkrI GCNGC 1 cut(s) 72
Psp6I CCWGG 2 cut(s) 114, 215
PspGI CCWGG 2 cut(s) 114, 215
PvuII CAGCTG 1 cut(s) 38
SatI GCNGC 1 cut(s) 71
Sau3AI GATC 1 cut(s) 40
ScrFI CCNGG 2 cut(s) 116, 217
SetI ASST 2 cut(s) 40, 66
SmlI CTYRAG 1 cut(s) 65
SmoI CTYRAG 1 cut(s) 65
Sse9I AATT 1 cut(s) 88
SsiI CCGC 1 cut(s) 70
SspI AATATT 1 cut(s) 130
StyD4I CCNGG 2 cut(s) 114, 215
TaaI ACNGT 3 cut(s) 139, 160, 187
TaqI TCGA 1 cut(s) 18
TasI AATT 1 cut(s) 88
TauI GCSGC 1 cut(s) 73
TscAI CASTG 1 cut(s) 192
TseFI GTSAC 1 cut(s) 146
Tsp45I GTSAC 1 cut(s) 146
TspDTI ATGAA 2 cut(s) 17, 88
TspRI CASTG 1 cut(s) 192
XagI CCTNNNNNAGG 1 cut(s) 241
XapI RAATTY 1 cut(s) 88
XcmI CCANNNNNNNNNTGG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.