Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8121168.1

Orthogroup ID

OG0003381

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 620

Gene Structure 619 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8121168.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 538 bp

tgcagagggtgcggatgagcaaagcaacacgaagcaagatggtggtagtccggaagaaaaggcaggggagttgtcagtcgaagagtttgagtctgcatccggtggtggttctgaggccatcaacagcgcttccattcaagaagatttgcaagaagatttgcaacgtgaatcaacttctgatgacaagtcagtcgagcctgaaacgttaacaaggcagtttgatctgcctgaatctgatcatggcaatgattcttttgttgcctctgggcttgaggattctgatagtagcctcgctgtaggtacaggagatttgacttctgaacttaaagagaacccggttagtgtcgaaccaatcaagttgccagtctctgacactatgaattcaaaccttagcattgaaccccaggatgaaattcctggggcaagtgaaaatcaaactgccacttctgagtcttccactgttattgcacatgaacacaatgaatctgtagctgtggatgtttcagtttcttcggaatcaaacattcttttagaacct

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SLH

Protein Analysis

179

Amino Acids

18.79

Weight (kDa)

4.05

Isoelectric Point (pI)

64.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003381)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G23890 AT5G23890 AT5G52410 AT5G52410 AT5G52410
fragaria_vesca	FvH4_7g29760 FvH4_7g29760 FvH4_7g29760 FvH4_7g29760 FvH4_7g29760 FvH4_7g29760
malus_domestica	MD01G1204600.v1.1 MD07G1273100.v1.1
prunus_persica	Prupe.2G296700_v2.0.a1 Prupe.2G296700_v2.0.a1 Prupe.2G296700_v2.0.a1 Prupe.2G296700_v2.0.a1
pyrus_communis	pycom01g21410 pycom07g24950 pycom07g24960
rosa_chinensis	RchiOBHm_Chr1g0377741
rosa_laevigata	RLG00000026502
rosa_multiflora	Rmu_co7992088.1_g000001 Rmu_co8121168.1_g000001 Rmu_co8359937.1_g000001 Rmu_sc0005758.1_g000001 Rmu_sc0040285.1_g000001
rosa_roxburghii	Rroxscaffold_4G00281100
rosa_rugosa	Rorug01G0404500 Rorug01G0404500 Rorug01G0404500
rosa_samantha	Rh1AG427700 Rh1BG381600 Rh1CG395500 Rh1DG412600
rosa_wichuraiana	Rw1G037080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	189
AccIII	TCCGGA	1 cut(s)	50
AciI	CCGC	1 cut(s)	12
AclI	AACGTT	1 cut(s)	204
AcsI	RAATTY	2 cut(s)	380, 412
AfaI	GTAC	1 cut(s)	302
AfeI	AGCGCT	1 cut(s)	128
AgsI	TTSAA	3 cut(s)	138, 385, 399
AjnI	CCWGG	2 cut(s)	403, 416
AluBI	AGCT	1 cut(s)	492
AluI	AGCT	1 cut(s)	492
Alw26I	GTCTC	1 cut(s)	371
AlwNI	CAGNNNCTG	1 cut(s)	369
Aor13HI	TCCGGA	1 cut(s)	50
Aor51HI	AGCGCT	1 cut(s)	128
AoxI	GGCC	1 cut(s)	115
ApoI	RAATTY	2 cut(s)	380, 412
AspLEI	GCGC	1 cut(s)	129
AsuC2I	CCSGG	1 cut(s)	336
BbsI	GAAGAC	1 cut(s)	445
BccI	CCATC	2 cut(s)	33, 126
BciT130I	CCWGG	2 cut(s)	405, 418
BclI	TGATCA	1 cut(s)	236
BcnI	CCSGG	1 cut(s)	336
BcoDI	GTCTC	1 cut(s)	371
BfmI	CTRYAG	2 cut(s)	295, 487
BfoI	RGCGCY	1 cut(s)	130
Bme1390I	CCNGG	3 cut(s)	336, 405, 418
BmrFI	CCNGG	3 cut(s)	336, 405, 418
BmsI	GCATC	1 cut(s)	105
BpiI	GAAGAC	1 cut(s)	445
Bpu10I	CCTNAGC	1 cut(s)	390
BpuEI	CTTGAG	1 cut(s)	291
BpuMI	CCSGG	1 cut(s)	336
BsaJI	CCNNGG	2 cut(s)	403, 417
BsaWI	WCCGGW	2 cut(s)	50, 99
Bse1I	ACTGG	1 cut(s)	363
Bse3DI	GCAATG	1 cut(s)	251
BseAI	TCCGGA	1 cut(s)	50
BseBI	CCWGG	2 cut(s)	405, 418
BseDI	CCNNGG	2 cut(s)	403, 417
BseGI	GGATG	4 cut(s)	20, 96, 413, 503
BseMI	GCAATG	1 cut(s)	251
BseMII	CTCAG	2 cut(s)	103, 439
BseNI	ACTGG	1 cut(s)	363
BshFI	GGCC	1 cut(s)	117
BsiSI	CCGG	3 cut(s)	51, 100, 336
BsmAI	GTCTC	1 cut(s)	371
BsnI	GGCC	1 cut(s)	117
Bsp13I	TCCGGA	1 cut(s)	50
Bsp143I	GATC	2 cut(s)	221, 236
BspACI	CCGC	1 cut(s)	12
BspANI	GGCC	1 cut(s)	117
BspCNI	CTCAG	2 cut(s)	104, 440
BspEI	TCCGGA	1 cut(s)	50
BsrDI	GCAATG	1 cut(s)	251
BsrI	ACTGG	1 cut(s)	363
BssECI	CCNNGG	2 cut(s)	403, 417
BssMI	GATC	2 cut(s)	221, 236
Bst2UI	CCWGG	2 cut(s)	405, 418
Bst4CI	ACNGT	1 cut(s)	461
Bst6I	CTCTTC	1 cut(s)	76
BstAPI	GCANNNNNTGC	1 cut(s)	9
BstDEI	CTNAG	3 cut(s)	112, 390, 448
BstF5I	GGATG	4 cut(s)	20, 96, 413, 503
BstH2I	RGCGCY	1 cut(s)	130
BstHHI	GCGC	1 cut(s)	129
BstKTI	GATC	2 cut(s)	224, 239
BstMAI	GTCTC	1 cut(s)	371
BstMBI	GATC	2 cut(s)	221, 236
BstMWI	GCNNNNNNNGC	1 cut(s)	9
BstNI	CCWGG	2 cut(s)	405, 418
BstSCI	CCNGG	3 cut(s)	334, 403, 416
BstSFI	CTRYAG	2 cut(s)	295, 487
BstV2I	GAAGAC	1 cut(s)	445
BsuRI	GGCC	1 cut(s)	117
BtsCI	GGATG	4 cut(s)	20, 96, 413, 503
BtsIMutI	CAGTG	1 cut(s)	457
CaiI	CAGNNNCTG	1 cut(s)	369
CfoI	GCGC	1 cut(s)	129
Csp6I	GTAC	1 cut(s)	301
CspCI	CAANNNNNGTGG	2 cut(s)	446, 481
CviAII	CATG	2 cut(s)	240, 471
CviJI	RGCY	5 cut(s)	117, 197, 269, 289, 492
CviKI_1	RGCY	5 cut(s)	117, 197, 269, 289, 492
CviQI	GTAC	1 cut(s)	301
DdeI	CTNAG	3 cut(s)	112, 390, 448
DpnI	GATC	2 cut(s)	223, 238
DpnII	GATC	2 cut(s)	221, 236
DrdI	GACNNNNNNGTC	1 cut(s)	189
DseDI	GACNNNNNNGTC	1 cut(s)	189
Eam1104I	CTCTTC	1 cut(s)	76
EarI	CTCTTC	1 cut(s)	76
Eco47III	AGCGCT	1 cut(s)	128
EcoRI	GAATTC	1 cut(s)	380
EcoRII	CCWGG	2 cut(s)	403, 416
FaeI	CATG	2 cut(s)	243, 474
FaiI	YATR	3 cut(s)	241, 378, 472
FatI	CATG	2 cut(s)	239, 470
FbaI	TGATCA	1 cut(s)	236
FokI	GGATG	4 cut(s)	27, 83, 420, 510
GlaI	GCGC	1 cut(s)	128
HaeII	RGCGCY	1 cut(s)	130
HaeIII	GGCC	1 cut(s)	117
HapII	CCGG	3 cut(s)	51, 100, 336
HhaI	GCGC	1 cut(s)	129
Hin1II	CATG	2 cut(s)	243, 474
Hin6I	GCGC	1 cut(s)	127
HinP1I	GCGC	1 cut(s)	127
HincII	GTYRAC	1 cut(s)	208
HindII	GTYRAC	1 cut(s)	208
HinfI	GANTC	8 cut(s)	90, 168, 231, 249, 276, 450, 483, 516
HpaI	GTTAAC	1 cut(s)	208
HpaII	CCGG	3 cut(s)	51, 100, 336
Hpy166II	GTNNAC	1 cut(s)	208
Hpy188I	TCNGA	8 cut(s)	113, 179, 236, 281, 320, 371, 449, 515
Hpy188III	TCNNGA	2 cut(s)	51, 138
Hpy8I	GTNNAC	1 cut(s)	208
HpyCH4III	ACNGT	1 cut(s)	461
HpyCH4IV	ACGT	2 cut(s)	164, 204
HpyCH4V	TGCA	5 cut(s)	3, 96, 149, 161, 468
HpyF10VI	GCNNNNNNNGC	1 cut(s)	9
HpyF3I	CTNAG	3 cut(s)	112, 390, 448
HpySE526I	ACGT	2 cut(s)	164, 204
Hsp92II	CATG	2 cut(s)	243, 474
HspAI	GCGC	1 cut(s)	127
Kpn2I	TCCGGA	1 cut(s)	50
Ksp22I	TGATCA	1 cut(s)	236
KspAI	GTTAAC	1 cut(s)	208
Kzo9I	GATC	2 cut(s)	221, 236
LweI	GCATC	1 cut(s)	105
MaeII	ACGT	2 cut(s)	164, 204
MalI	GATC	2 cut(s)	223, 238
MboI	GATC	2 cut(s)	221, 236
MboII	GAAGA	6 cut(s)	66, 93, 153, 165, 445, 502
MluCI	AATT	2 cut(s)	380, 412
MlyI	GAGTC	2 cut(s)	99, 459
MnlI	CCTC	4 cut(s)	107, 266, 272, 300
MroI	TCCGGA	1 cut(s)	50
MseI	TTAA	2 cut(s)	207, 325
MslI	CAYNNNNRTG	1 cut(s)	244
MspI	CCGG	3 cut(s)	51, 100, 336
MspR9I	CCNGG	3 cut(s)	336, 405, 418
MvaI	CCWGG	2 cut(s)	405, 418
MwoI	GCNNNNNNNGC	1 cut(s)	9
NciI	CCSGG	1 cut(s)	336
NdeII	GATC	2 cut(s)	221, 236
NlaIII	CATG	2 cut(s)	243, 474
PfeI	GAWTC	6 cut(s)	168, 231, 249, 276, 483, 516
PleI	GAGTC	2 cut(s)	98, 458
PpsI	GAGTC	2 cut(s)	98, 458
Psp1406I	AACGTT	1 cut(s)	204
Psp6I	CCWGG	2 cut(s)	403, 416
PspGI	CCWGG	2 cut(s)	403, 416
PstNI	CAGNNNCTG	1 cut(s)	369
RsaI	GTAC	1 cut(s)	302
RsaNI	GTAC	1 cut(s)	301
RseI	CAYNNNNRTG	1 cut(s)	244
SaqAI	TTAA	2 cut(s)	207, 325
Sau3AI	GATC	2 cut(s)	221, 236
SchI	GAGTC	2 cut(s)	99, 459
ScrFI	CCNGG	3 cut(s)	336, 405, 418
SetI	ASST	5 cut(s)	167, 207, 302, 391, 494
SfaNI	GCATC	1 cut(s)	105
SfcI	CTRYAG	2 cut(s)	295, 487
SmiMI	CAYNNNNRTG	1 cut(s)	244
SmlI	CTYRAG	1 cut(s)	270
SmoI	CTYRAG	1 cut(s)	270
Sse9I	AATT	2 cut(s)	380, 412
SsiI	CCGC	1 cut(s)	12
StyD4I	CCNGG	3 cut(s)	334, 403, 416
TaaI	ACNGT	1 cut(s)	461
TaiI	ACGT	2 cut(s)	167, 207
TaqI	TCGA	3 cut(s)	79, 193, 346
TasI	AATT	2 cut(s)	380, 412
TfiI	GAWTC	6 cut(s)	168, 231, 249, 276, 483, 516
Tru1I	TTAA	2 cut(s)	207, 325
Tru9I	TTAA	2 cut(s)	207, 325
TscAI	CASTG	1 cut(s)	464
TspDTI	ATGAA	4 cut(s)	393, 424, 487, 496
TspRI	CASTG	1 cut(s)	464
XapI	RAATTY	2 cut(s)	380, 412

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.