Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8130356.1

Orthogroup ID

OG0004262

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 431

Gene Structure 431 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8130356.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 271 bp

ctgactgataattttggcacaaaggccttaattggtgagggttcatatggaagagtatattatggtgttcttaagagtgggcctgctgctgctattaagaagctagatgccagtaaacaaccacaccaagaatttttgtcacaggtctccatggtttcaagactaaaacatgaaaatgtcgttgaacttgttggttattgtattgatggccctctgcgtctccttgcctatgagtatgctcctaatgggtctcttcatgatattcttcatg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0023052 GO:0036211 GO:0038023 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0060089 GO:0065007 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04626 map04626

Pfam Domains

Protein Families

Pkinase_Tyr

Protein Analysis

90

Amino Acids

9.86

Weight (kDa)

7.09

Isoelectric Point (pI)

18.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004262)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G48210 AT1G48210 AT1G48210 AT1G48210 AT1G48210 AT1G48210 AT1G48210 AT1G48220 AT3G17410 AT3G17410
fragaria_vesca	FvH4_4g21440 FvH4_4g21440 FvH4_4g21440
malus_domestica	MD13G1141200.v1.1 MD16G1137300.v1.1
prunus_persica	Prupe.1G106400_v2.0.a1 Prupe.1G106400_v2.0.a1 Prupe.1G106400_v2.0.a1 Prupe.1G106400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0427371
rosa_laevigata	RLG00000007249
rosa_multiflora	Rmu_co8130356.1_g000001 Rmu_co8298183.1_g000001 Rmu_sc0003813.1_g000019
rosa_roxburghii	Rroxscaffold_1G00008890 Rroxscaffold_5G00369040
rosa_rugosa	Rorug04G0217100
rosa_samantha	Rh4AG273500 Rh4BG279100 Rh4DG276500 Rh5DG369800
rosa_wichuraiana	Rw4G023720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	131
AflII	CTTAAG	1 cut(s)	71
AgsI	TTSAA	2 cut(s)	159, 185
AluBI	AGCT	1 cut(s)	103
AluI	AGCT	1 cut(s)	103
Alw26I	GTCTC	3 cut(s)	151, 224, 255
AoxI	GGCC	3 cut(s)	24, 80, 208
ApeKI	GCWGC	2 cut(s)	86, 89
ApoI	RAATTY	1 cut(s)	131
AspS9I	GGNCC	2 cut(s)	80, 209
AsuHPI	GGTGA	1 cut(s)	47
BbvI	GCAGC	2 cut(s)	73, 76
BccI	CCATC	1 cut(s)	200
BcoDI	GTCTC	3 cut(s)	151, 224, 255
BfaI	CTAG	1 cut(s)	104
BfrI	CTTAAG	1 cut(s)	71
BisI	GCNGC	2 cut(s)	87, 90
BlsI	GCNGC	2 cut(s)	88, 91
BmgT120I	GGNCC	2 cut(s)	80, 209
BmsI	GCATC	1 cut(s)	97
BsaI	GGTCTC	2 cut(s)	151, 255
BsaJI	CCNNGG	1 cut(s)	150
Bse1I	ACTGG	1 cut(s)	111
BseDI	CCNNGG	1 cut(s)	150
BseNI	ACTGG	1 cut(s)	111
BseXI	GCAGC	2 cut(s)	73, 76
BshFI	GGCC	3 cut(s)	26, 82, 210
BsmAI	GTCTC	3 cut(s)	151, 224, 255
BsmBI	CGTCTC	1 cut(s)	224
BsnI	GGCC	3 cut(s)	26, 82, 210
Bso31I	GGTCTC	2 cut(s)	151, 255
Bsp19I	CCATGG	1 cut(s)	150
BspANI	GGCC	3 cut(s)	26, 82, 210
BspHI	TCATGA	1 cut(s)	256
BspTI	CTTAAG	1 cut(s)	71
BspTNI	GGTCTC	2 cut(s)	151, 255
BsrI	ACTGG	1 cut(s)	111
BssECI	CCNNGG	1 cut(s)	150
BssT1I	CCWWGG	1 cut(s)	150
Bst6I	CTCTTC	2 cut(s)	46, 258
BstAFI	CTTAAG	1 cut(s)	71
BstC8I	GCNNGC	1 cut(s)	84
BstDSI	CCRYGG	1 cut(s)	150
BstMAI	GTCTC	3 cut(s)	151, 224, 255
BstV1I	GCAGC	2 cut(s)	73, 76
BsuRI	GGCC	3 cut(s)	26, 82, 210
BtgI	CCRYGG	1 cut(s)	150
Cac8I	GCNNGC	1 cut(s)	84
CciI	TCATGA	1 cut(s)	256
Cfr13I	GGNCC	2 cut(s)	80, 209
CseI	GACGC	1 cut(s)	206
CviAII	CATG	4 cut(s)	151, 170, 257, 269
CviJI	RGCY	4 cut(s)	26, 82, 103, 210
CviKI_1	RGCY	4 cut(s)	26, 82, 103, 210
Eam1104I	CTCTTC	2 cut(s)	46, 258
EarI	CTCTTC	2 cut(s)	46, 258
Eco130I	CCWWGG	1 cut(s)	150
Eco147I	AGGCCT	1 cut(s)	26
Eco31I	GGTCTC	2 cut(s)	151, 255
EcoT14I	CCWWGG	1 cut(s)	150
ErhI	CCWWGG	1 cut(s)	150
Esp3I	CGTCTC	1 cut(s)	224
FaeI	CATG	3 cut(s)	154, 173, 260
FatI	CATG	3 cut(s)	150, 169, 256
FauNDI	CATATG	1 cut(s)	46
Fnu4HI	GCNGC	2 cut(s)	87, 90
Fsp4HI	GCNGC	2 cut(s)	87, 90
FspBI	CTAG	1 cut(s)	104
GluI	GCNGC	2 cut(s)	87, 90
HaeIII	GGCC	3 cut(s)	26, 82, 210
HgaI	GACGC	1 cut(s)	206
Hin1II	CATG	3 cut(s)	154, 173, 260
HphI	GGTGA	1 cut(s)	47
Hpy166II	GTNNAC	1 cut(s)	116
Hpy188III	TCNNGA	2 cut(s)	159, 257
Hpy8I	GTNNAC	1 cut(s)	116
Hsp92II	CATG	3 cut(s)	154, 173, 260
LmnI	GCTCC	1 cut(s)	244
LpnPI	CCDG	3 cut(s)	96, 124, 128
Lsp1109I	GCAGC	2 cut(s)	73, 76
LweI	GCATC	1 cut(s)	97
MaeI	CTAG	1 cut(s)	104
MaeIII	GTNAC	1 cut(s)	138
MboII	GAAGA	3 cut(s)	63, 245, 257
MluCI	AATT	3 cut(s)	10, 30, 131
MnlI	CCTC	2 cut(s)	31, 222
MseI	TTAA	3 cut(s)	29, 72, 96
MslI	CAYNNNNRTG	1 cut(s)	174
MspCI	CTTAAG	1 cut(s)	71
NcoI	CCATGG	1 cut(s)	150
NdeI	CATATG	1 cut(s)	46
NlaIII	CATG	3 cut(s)	154, 173, 260
NmuCI	GTSAC	1 cut(s)	138
PagI	TCATGA	1 cut(s)	256
PceI	AGGCCT	1 cut(s)	26
PkrI	GCNGC	2 cut(s)	88, 91
PspPI	GGNCC	2 cut(s)	80, 209
RseI	CAYNNNNRTG	1 cut(s)	174
SaqAI	TTAA	3 cut(s)	29, 72, 96
SatI	GCNGC	2 cut(s)	87, 90
Sau96I	GGNCC	2 cut(s)	80, 209
SetI	ASST	2 cut(s)	105, 147
SfaNI	GCATC	1 cut(s)	97
SmiMI	CAYNNNNRTG	1 cut(s)	174
SmlI	CTYRAG	1 cut(s)	71
SmoI	CTYRAG	1 cut(s)	71
Sse9I	AATT	3 cut(s)	10, 30, 131
SseBI	AGGCCT	1 cut(s)	26
SspMI	CTAG	1 cut(s)	104
StuI	AGGCCT	1 cut(s)	26
StyI	CCWWGG	1 cut(s)	150
TasI	AATT	3 cut(s)	10, 30, 131
Tru1I	TTAA	3 cut(s)	29, 72, 96
Tru9I	TTAA	3 cut(s)	29, 72, 96
TseFI	GTSAC	1 cut(s)	138
TseI	GCWGC	2 cut(s)	86, 89
Tsp45I	GTSAC	1 cut(s)	138
TspDTI	ATGAA	4 cut(s)	33, 186, 245, 257
Vha464I	CTTAAG	1 cut(s)	71
XapI	RAATTY	1 cut(s)	131
XspI	CTAG	1 cut(s)	104

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.