Rmu_co8150174.1_g000001

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8150174.1
Physical Location & Seq
Reverse (-)
2 .. 631
630 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8150174.1_g000001.1.cds

Sequence Viewer

Length: 267 bp
atgtgtggtcaaatcaacttattacatcctagaaagcaggatgcagtagattttgatgataaaagcagctgggagtacctcttcaaggattattggacagacttaaaggagaggttatctctaacgcttgatgatctttcacaggccaagaatccatggaaaggatcagctgggcatgctaataaaaatgggtcacatgatgaaccttatgatgctaatattgatggagggtctgattccgataattctgagaatttggattcaact

Protein Analysis

89

Amino Acids

10.03

Weight (kDa)

4.45

Isoelectric Point (pI)

27.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 172
AcsI RAATTY 1 cut(s) 253
AfaI GTAC 1 cut(s) 77
AfiI CCNNNNNNNGG 2 cut(s) 85, 161
AgsI TTSAA 2 cut(s) 85, 264
AluBI AGCT 2 cut(s) 69, 170
AluI AGCT 2 cut(s) 69, 170
AlwI GGATC 1 cut(s) 172
AoxI GGCC 1 cut(s) 144
ApeKI GCWGC 1 cut(s) 66
ApoI RAATTY 1 cut(s) 253
BbvI GCAGC 1 cut(s) 78
BccI CCATC 1 cut(s) 218
BfaI CTAG 1 cut(s) 30
BisI GCNGC 1 cut(s) 67
BlsI GCNGC 1 cut(s) 68
BmsI GCATC 2 cut(s) 31, 202
BplI GAGNNNNNCTC 2 cut(s) 103, 135
BsaJI CCNNGG 1 cut(s) 155
Bsc4I CCNNNNNNNGG 2 cut(s) 85, 161
BseDI CCNNGG 1 cut(s) 155
BseGI GGATG 2 cut(s) 25, 46
BseLI CCNNNNNNNGG 2 cut(s) 85, 161
BseMII CTCAG 1 cut(s) 240
BseXI GCAGC 1 cut(s) 78
BseYI CCCAGC 2 cut(s) 69, 170
BshFI GGCC 1 cut(s) 146
BslI CCNNNNNNNGG 2 cut(s) 85, 161
BsnI GGCC 1 cut(s) 146
Bsp143I GATC 2 cut(s) 133, 164
Bsp19I CCATGG 1 cut(s) 155
BspANI GGCC 1 cut(s) 146
BspCNI CTCAG 1 cut(s) 241
BspPI GGATC 1 cut(s) 172
BssECI CCNNGG 1 cut(s) 155
BssMI GATC 2 cut(s) 133, 164
BssT1I CCWWGG 1 cut(s) 155
Bst6I CTCTTC 1 cut(s) 86
BstC8I GCNNGC 1 cut(s) 177
BstDEI CTNAG 1 cut(s) 249
BstDSI CCRYGG 1 cut(s) 155
BstENI CCTNNNNNAGG 1 cut(s) 83
BstF5I GGATG 2 cut(s) 25, 46
BstKTI GATC 2 cut(s) 136, 167
BstMBI GATC 2 cut(s) 133, 164
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstNSI RCATGY 1 cut(s) 179
BstV1I GCAGC 1 cut(s) 78
BsuRI GGCC 1 cut(s) 146
BtgI CCRYGG 1 cut(s) 155
BtsCI GGATG 2 cut(s) 25, 46
Cac8I GCNNGC 1 cut(s) 177
Csp6I GTAC 1 cut(s) 76
CviAII CATG 3 cut(s) 156, 176, 197
CviJI RGCY 3 cut(s) 69, 146, 170
CviKI_1 RGCY 3 cut(s) 69, 146, 170
CviQI GTAC 1 cut(s) 76
DdeI CTNAG 1 cut(s) 249
DpnI GATC 2 cut(s) 135, 166
DpnII GATC 2 cut(s) 133, 164
Eam1104I CTCTTC 1 cut(s) 86
EarI CTCTTC 1 cut(s) 86
Eco130I CCWWGG 1 cut(s) 155
EcoNI CCTNNNNNAGG 1 cut(s) 83
EcoT14I CCWWGG 1 cut(s) 155
ErhI CCWWGG 1 cut(s) 155
FaeI CATG 3 cut(s) 159, 179, 200
FaiI YATR 4 cut(s) 157, 177, 198, 210
FatI CATG 3 cut(s) 155, 175, 196
Fnu4HI GCNGC 1 cut(s) 67
FokI GGATG 2 cut(s) 12, 53
Fsp4HI GCNGC 1 cut(s) 67
FspBI CTAG 1 cut(s) 30
GluI GCNGC 1 cut(s) 67
GsaI CCCAGC 2 cut(s) 73, 174
HaeIII GGCC 1 cut(s) 146
Hin1II CATG 3 cut(s) 159, 179, 200
HinfI GANTC 3 cut(s) 151, 236, 260
Hpy188I TCNGA 3 cut(s) 235, 241, 250
HpyCH4V TGCA 1 cut(s) 44
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 249
Hsp92II CATG 3 cut(s) 159, 179, 200
Kzo9I GATC 2 cut(s) 133, 164
LpnPI CCDG 4 cut(s) 23, 55, 128, 156
Lsp1109I GCAGC 1 cut(s) 78
LweI GCATC 2 cut(s) 31, 202
MaeI CTAG 1 cut(s) 30
MaeIII GTNAC 1 cut(s) 192
MalI GATC 2 cut(s) 135, 166
MboI GATC 2 cut(s) 133, 164
MboII GAAGA 1 cut(s) 73
MluCI AATT 2 cut(s) 244, 253
MnlI CCTC 3 cut(s) 89, 105, 221
MseI TTAA 1 cut(s) 104
MspA1I CMGCKG 2 cut(s) 69, 170
MwoI GCNNNNNNNGC 1 cut(s) 176
NcoI CCATGG 1 cut(s) 155
NdeII GATC 2 cut(s) 133, 164
NlaIII CATG 3 cut(s) 159, 179, 200
NmuCI GTSAC 1 cut(s) 192
NspI RCATGY 1 cut(s) 179
PaeI GCATGC 1 cut(s) 179
PfeI GAWTC 3 cut(s) 151, 236, 260
PkrI GCNGC 1 cut(s) 68
PspFI CCCAGC 2 cut(s) 69, 170
PvuII CAGCTG 2 cut(s) 69, 170
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
SaqAI TTAA 1 cut(s) 104
SatI GCNGC 1 cut(s) 67
Sau3AI GATC 2 cut(s) 133, 164
SetI ASST 5 cut(s) 71, 81, 116, 172, 208
SfaNI GCATC 2 cut(s) 31, 202
SphI GCATGC 1 cut(s) 179
Sse9I AATT 2 cut(s) 244, 253
SspI AATATT 1 cut(s) 220
SspMI CTAG 1 cut(s) 30
StyI CCWWGG 1 cut(s) 155
TasI AATT 2 cut(s) 244, 253
TfiI GAWTC 3 cut(s) 151, 236, 260
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TseFI GTSAC 1 cut(s) 192
TseI GCWGC 1 cut(s) 66
Tsp45I GTSAC 1 cut(s) 192
TspDTI ATGAA 1 cut(s) 216
XagI CCTNNNNNAGG 1 cut(s) 83
XapI RAATTY 1 cut(s) 253
XceI RCATGY 1 cut(s) 179
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.