Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8165832.1

Orthogroup ID

OG0002230

Physical Location & Seq

Genomic Coordinates Forward (+)

106 .. 381

Gene Structure 276 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8165832.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 276 bp

atggatgccaatggaccagatctgttcaacaacaagaagcaagcaatggaggctgttgatggcaggccagcttcaagagcttcaaacttggccgttgccccgtcggataacacttctgggtttcagacagttccagggaagttcactgactgcctctttggacaagagcctggacggacagtcaacttagttgatagaaacattcagtctgttggcagtggaactactaattttggaagaaaagggtttcagaatcaatatggcaatgatcaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Jas

Protein Analysis

91

Amino Acids

9.73

Weight (kDa)

6.09

Isoelectric Point (pI)

27.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002230)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G13660 AT5G13660 AT5G13660 AT5G13660 AT5G13660 AT5G13660 AT5G13660
fragaria_vesca	FvH4_7g21830 FvH4_7g21830 FvH4_7g21830
malus_domestica	MD01G1123100.v1.1 MD07G1192800.v1.1
prunus_persica	Prupe.2G230700_v2.0.a1
pyrus_communis	pycom01g15000 pycom07g18230
rosa_chinensis	RchiOBHm_Chr1g0366111 RchiOBHm_Chr7g0232731
rosa_laevigata	RLG00000017112 RLG00000027367
rosa_multiflora	Rmu_co7957917.1_g000001 Rmu_co8165832.1_g000001 Rmu_sc0003987.1_g000004 Rmu_sc0005795.1_g000008
rosa_roxburghii	Rroxscaffold_3G00227900 Rroxscaffold_4G00290490
rosa_rugosa	Rorug01G0133500.1 Rorug01G0327400 Rorug01G0327500 Rorug01G0327600
rosa_samantha	Rh1AG335600 Rh1BG296800 Rh1CG313000 Rh1DG328700 Rh2AG150700 Rh2AG150900 Rh2BG156400 Rh2DG156300 Rh2DG156500 Rh7AG431000 Rh7AG431100 Rh7CG449600 Rh7CG449700
rosa_wichuraiana	Rw1G029770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	90
AgsI	TTSAA	3 cut(s)	28, 75, 84
AhdI	GACNNNNNGTC	1 cut(s)	179
AjnI	CCWGG	2 cut(s)	133, 169
AluBI	AGCT	2 cut(s)	71, 80
AluI	AGCT	2 cut(s)	71, 80
AoxI	GGCC	2 cut(s)	65, 90
ArsI	GACNNNNNNTTYG	2 cut(s)	140, 172
AspS9I	GGNCC	1 cut(s)	14
AvaII	GGWCC	1 cut(s)	14
BccI	CCATC	1 cut(s)	53
BceAI	ACGGC	1 cut(s)	77
BciT130I	CCWGG	2 cut(s)	135, 171
BclI	TGATCA	1 cut(s)	268
BglII	AGATCT	1 cut(s)	19
Bme1390I	CCNGG	2 cut(s)	135, 171
Bme18I	GGWCC	1 cut(s)	14
BmeRI	GACNNNNNGTC	1 cut(s)	179
BmgT120I	GGNCC	1 cut(s)	14
BmrFI	CCNGG	2 cut(s)	135, 171
BsaJI	CCNNGG	1 cut(s)	134
Bse3DI	GCAATG	2 cut(s)	51, 271
BseBI	CCWGG	2 cut(s)	135, 171
BseDI	CCNNGG	1 cut(s)	134
BseGI	GGATG	1 cut(s)	10
BseMI	GCAATG	2 cut(s)	51, 271
BshFI	GGCC	2 cut(s)	67, 92
BsnI	GGCC	2 cut(s)	67, 92
Bsp143I	GATC	2 cut(s)	19, 268
BspANI	GGCC	2 cut(s)	67, 92
BsrDI	GCAATG	2 cut(s)	51, 271
BssECI	CCNNGG	1 cut(s)	134
BssMI	GATC	2 cut(s)	19, 268
Bst2UI	CCWGG	2 cut(s)	135, 171
Bst4CI	ACNGT	2 cut(s)	130, 181
BstC8I	GCNNGC	3 cut(s)	42, 65, 69
BstDEI	CTNAG	1 cut(s)	187
BstF5I	GGATG	1 cut(s)	10
BstKTI	GATC	2 cut(s)	22, 271
BstMBI	GATC	2 cut(s)	19, 268
BstMWI	GCNNNNNNNGC	2 cut(s)	50, 77
BstNI	CCWGG	2 cut(s)	135, 171
BstSCI	CCNGG	2 cut(s)	133, 169
BstX2I	RGATCY	1 cut(s)	19
BstYI	RGATCY	1 cut(s)	19
BsuRI	GGCC	2 cut(s)	67, 92
BtsCI	GGATG	1 cut(s)	10
BtsI	GCAGTG	1 cut(s)	223
BtsIMutI	CAGTG	2 cut(s)	144, 223
Cac8I	GCNNGC	3 cut(s)	42, 65, 69
Cfr13I	GGNCC	1 cut(s)	14
CviJI	RGCY	6 cut(s)	53, 67, 71, 80, 92, 169
CviKI_1	RGCY	6 cut(s)	53, 67, 71, 80, 92, 169
DdeI	CTNAG	1 cut(s)	187
DpnI	GATC	2 cut(s)	21, 270
DpnII	GATC	2 cut(s)	19, 268
DriI	GACNNNNNGTC	1 cut(s)	179
EaeI	YGGCCR	1 cut(s)	90
Eam1105I	GACNNNNNGTC	1 cut(s)	179
Eco47I	GGWCC	1 cut(s)	14
EcoRII	CCWGG	2 cut(s)	133, 169
FaiI	YATR	1 cut(s)	261
FbaI	TGATCA	1 cut(s)	268
FokI	GGATG	1 cut(s)	17
HaeIII	GGCC	2 cut(s)	67, 92
HincII	GTYRAC	1 cut(s)	184
HindII	GTYRAC	1 cut(s)	184
HinfI	GANTC	1 cut(s)	253
Hpy166II	GTNNAC	2 cut(s)	144, 184
Hpy188I	TCNGA	3 cut(s)	106, 126, 252
Hpy188III	TCNNGA	1 cut(s)	75
Hpy8I	GTNNAC	2 cut(s)	144, 184
Hpy99I	CGWCG	1 cut(s)	106
HpyCH4III	ACNGT	2 cut(s)	130, 181
HpyF10VI	GCNNNNNNNGC	2 cut(s)	50, 77
HpyF3I	CTNAG	1 cut(s)	187
Ksp22I	TGATCA	1 cut(s)	268
Kzo9I	GATC	2 cut(s)	19, 268
LpnPI	CCDG	8 cut(s)	30, 49, 81, 102, 120, 147, 156, 183
MalI	GATC	2 cut(s)	21, 270
MboI	GATC	2 cut(s)	19, 268
MboII	GAAGA	1 cut(s)	249
MflI	RGATCY	1 cut(s)	19
MluCI	AATT	1 cut(s)	229
MmeI	TCCRAC	1 cut(s)	84
MnlI	CCTC	2 cut(s)	43, 164
MspR9I	CCNGG	2 cut(s)	135, 171
MvaI	CCWGG	2 cut(s)	135, 171
MwoI	GCNNNNNNNGC	2 cut(s)	50, 77
NdeII	GATC	2 cut(s)	19, 268
PfeI	GAWTC	1 cut(s)	253
Psp6I	CCWGG	2 cut(s)	133, 169
PspGI	CCWGG	2 cut(s)	133, 169
PspPI	GGNCC	1 cut(s)	14
PsuI	RGATCY	1 cut(s)	19
Sau3AI	GATC	2 cut(s)	19, 268
Sau96I	GGNCC	1 cut(s)	14
ScrFI	CCNGG	2 cut(s)	135, 171
SetI	ASST	2 cut(s)	73, 82
SinI	GGWCC	1 cut(s)	14
Sse9I	AATT	1 cut(s)	229
StyD4I	CCNGG	2 cut(s)	133, 169
TaaI	ACNGT	2 cut(s)	130, 181
TasI	AATT	1 cut(s)	229
TfiI	GAWTC	1 cut(s)	253
TscAI	CASTG	2 cut(s)	151, 223
TspGWI	ACGGA	1 cut(s)	190
TspRI	CASTG	2 cut(s)	151, 223
VpaK11BI	GGWCC	1 cut(s)	14

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.