Rh2DG156300

TPL-binding domain in jasmonate signalling

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
13090845 .. 13092726
1882 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG156300.1

Sequence Viewer

Length: 378 bp
ATGTCTTTCCAGCCCAAAAGCTTTCGGATTCCAAGAGATGCTAGCTATCTGTTCAACAACAAGAAGCAAGCAATGGAGGCTGTTGATGGCAGGCCAGCTTCAAGAGCTTCAAACTTGGCCGTTGCCCCGTCGGATAACACTTCTGGGTTTCAGACAGTTCCAGGGAAGTTCACTGACTGCCTCTTTGGACAAGAGCCTGGACGGACAGTCAACTTAGTTGATAGAAACATTCAGTCTGTTGGCAGTGGAACTACTAATTTTGGAAGAAAAGGGTTTCAGAATCAATATGGCAATGATCAATCAGTGGATCTGTCAATGTCCCACACCATCGAAGATCCTTCATCATGTCTAGGGTTTAGGGGTGGATCAAGGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

13.59

Weight (kDa)

9.39

Isoelectric Point (pI)

47.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 315, 329, 373
AcoI YGGCCR 1 cut(s) 117
AgsI TTSAA 3 cut(s) 55, 102, 111
AhdI GACNNNNNGTC 1 cut(s) 206
AjnI CCWGG 2 cut(s) 160, 196
AluBI AGCT 4 cut(s) 21, 45, 98, 107
AluI AGCT 4 cut(s) 21, 45, 98, 107
AlwI GGATC 3 cut(s) 315, 329, 373
AoxI GGCC 2 cut(s) 92, 117
ArsI GACNNNNNNTTYG 2 cut(s) 167, 199
AsuNHI GCTAGC 1 cut(s) 41
BccI CCATC 2 cut(s) 80, 335
BceAI ACGGC 1 cut(s) 104
BciT130I CCWGG 2 cut(s) 162, 198
BclI TGATCA 1 cut(s) 295
BfaI CTAG 2 cut(s) 42, 350
Bme1390I CCNGG 2 cut(s) 162, 198
BmeRI GACNNNNNGTC 1 cut(s) 206
BmrFI CCNGG 2 cut(s) 162, 198
BmsI GCATC 1 cut(s) 28
BmtI GCTAGC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 161
Bse3DI GCAATG 2 cut(s) 78, 298
BseBI CCWGG 2 cut(s) 162, 198
BseDI CCNNGG 1 cut(s) 161
BseMI GCAATG 2 cut(s) 78, 298
BshFI GGCC 2 cut(s) 94, 119
BslFI GGGAC 1 cut(s) 304
BsmFI GGGAC 1 cut(s) 304
BsnI GGCC 2 cut(s) 94, 119
Bsp143I GATC 4 cut(s) 295, 307, 334, 365
BspANI GGCC 2 cut(s) 94, 119
BspOI GCTAGC 1 cut(s) 45
BspPI GGATC 3 cut(s) 315, 329, 373
BsrDI GCAATG 2 cut(s) 78, 298
BssECI CCNNGG 1 cut(s) 161
BssMI GATC 4 cut(s) 295, 307, 334, 365
Bst2UI CCWGG 2 cut(s) 162, 198
Bst4CI ACNGT 2 cut(s) 157, 208
BstC8I GCNNGC 4 cut(s) 43, 69, 92, 96
BstDEI CTNAG 1 cut(s) 214
BstKTI GATC 4 cut(s) 298, 310, 337, 368
BstMBI GATC 4 cut(s) 295, 307, 334, 365
BstMWI GCNNNNNNNGC 2 cut(s) 77, 104
BstNI CCWGG 2 cut(s) 162, 198
BstSCI CCNGG 2 cut(s) 160, 196
BstX2I RGATCY 2 cut(s) 307, 334
BstYI RGATCY 2 cut(s) 307, 334
BsuRI GGCC 2 cut(s) 94, 119
BtsI GCAGTG 1 cut(s) 250
BtsIMutI CAGTG 3 cut(s) 171, 250, 309
Cac8I GCNNGC 4 cut(s) 43, 69, 92, 96
CviAII CATG 1 cut(s) 345
CviJI RGCY 9 cut(s) 13, 21, 45, 80, 94, 98, 107, 119, 196
CviKI_1 RGCY 9 cut(s) 13, 21, 45, 80, 94, 98, 107, 119, 196
DdeI CTNAG 1 cut(s) 214
DpnI GATC 4 cut(s) 297, 309, 336, 367
DpnII GATC 4 cut(s) 295, 307, 334, 365
DriI GACNNNNNGTC 1 cut(s) 206
EaeI YGGCCR 1 cut(s) 117
Eam1105I GACNNNNNGTC 1 cut(s) 206
EcoRII CCWGG 2 cut(s) 160, 196
FaeI CATG 1 cut(s) 348
FaiI YATR 2 cut(s) 288, 346
FaqI GGGAC 1 cut(s) 304
FatI CATG 1 cut(s) 344
FbaI TGATCA 1 cut(s) 295
FspBI CTAG 2 cut(s) 42, 350
HaeIII GGCC 2 cut(s) 94, 119
Hin1II CATG 1 cut(s) 348
HincII GTYRAC 1 cut(s) 211
HindII GTYRAC 1 cut(s) 211
HindIII AAGCTT 1 cut(s) 19
HinfI GANTC 2 cut(s) 28, 280
Hpy166II GTNNAC 2 cut(s) 171, 211
Hpy188I TCNGA 4 cut(s) 27, 133, 153, 279
Hpy188III TCNNGA 1 cut(s) 102
Hpy8I GTNNAC 2 cut(s) 171, 211
Hpy99I CGWCG 1 cut(s) 133
HpyAV CCTTC 1 cut(s) 348
HpyCH4III ACNGT 2 cut(s) 157, 208
HpyF10VI GCNNNNNNNGC 2 cut(s) 77, 104
HpyF3I CTNAG 1 cut(s) 214
Hsp92II CATG 1 cut(s) 348
Ksp22I TGATCA 1 cut(s) 295
Kzo9I GATC 4 cut(s) 295, 307, 334, 365
LpnPI CCDG 8 cut(s) 23, 76, 108, 129, 147, 174, 183, 210
LweI GCATC 1 cut(s) 28
MaeI CTAG 2 cut(s) 42, 350
MalI GATC 4 cut(s) 297, 309, 336, 367
MboI GATC 4 cut(s) 295, 307, 334, 365
MboII GAAGA 2 cut(s) 276, 344
MflI RGATCY 2 cut(s) 307, 334
MluCI AATT 1 cut(s) 256
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 2 cut(s) 70, 191
MspR9I CCNGG 2 cut(s) 162, 198
MvaI CCWGG 2 cut(s) 162, 198
MwoI GCNNNNNNNGC 2 cut(s) 77, 104
NdeII GATC 4 cut(s) 295, 307, 334, 365
NheI GCTAGC 1 cut(s) 41
NlaIII CATG 1 cut(s) 348
PfeI GAWTC 2 cut(s) 28, 280
Psp6I CCWGG 2 cut(s) 160, 196
PspGI CCWGG 2 cut(s) 160, 196
PsuI RGATCY 2 cut(s) 307, 334
Sau3AI GATC 4 cut(s) 295, 307, 334, 365
ScrFI CCNGG 2 cut(s) 162, 198
SetI ASST 4 cut(s) 23, 47, 100, 109
SfaNI GCATC 1 cut(s) 28
Sse9I AATT 1 cut(s) 256
SspMI CTAG 2 cut(s) 42, 350
StyD4I CCNGG 2 cut(s) 160, 196
TaaI ACNGT 2 cut(s) 157, 208
TaqI TCGA 1 cut(s) 330
TasI AATT 1 cut(s) 256
TfiI GAWTC 2 cut(s) 28, 280
TscAI CASTG 3 cut(s) 178, 250, 309
TspDTI ATGAA 1 cut(s) 330
TspGWI ACGGA 1 cut(s) 217
TspRI CASTG 3 cut(s) 178, 250, 309
XspI CTAG 2 cut(s) 42, 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.