Rmu_co8178212.1_g000001

Chloroplast envelope membrane

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8178212.1
Physical Location & Seq
Forward (+)
264 .. 682
419 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8178212.1_g000001.1.cds

Sequence Viewer

Length: 419 bp
atggtcttatgcgagaacttcgtctttgttaataaccacaacaagcagactttgttttcgcacaaaattgattcgcagtcgaggctcgcagcagcagcagttgaggtgggtcgaggaggaggaggaggacggaggtgcagtgggttcgttgccaatgccggaaagagaaaacggaaatggtggcagagcttcttcttcgacgaggaaggtaattggcttggtttgaaagacgatgacatgctggccgcggaggaggaggaggaggagaacttggattccaattcctactcggaagctgagaaatttgaggcgtggaagacaagggccgaagcaatcgtggatttgagggaagcacagcaggatatgagcaacgaggagaatcgcaagtgggaggattggcttgcggcggattcgaactc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

140

Amino Acids

16.02

Weight (kDa)

4.72

Isoelectric Point (pI)

63.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 248
AciI CCGC 4 cut(s) 246, 248, 404, 407
AcoI YGGCCR 1 cut(s) 243
AcsI RAATTY 1 cut(s) 302
AgsI TTSAA 1 cut(s) 226
AloI GAACNNNNNNTCC 2 cut(s) 260, 292
AluBI AGCT 2 cut(s) 189, 296
AluI AGCT 2 cut(s) 189, 296
AoxI GGCC 2 cut(s) 243, 324
ApeKI GCWGC 3 cut(s) 89, 92, 95
ApoI RAATTY 1 cut(s) 302
ArsI GACNNNNNNTTYG 2 cut(s) 40, 72
AspS9I GGNCC 1 cut(s) 324
AsuII TTCGAA 1 cut(s) 413
BbsI GAAGAC 1 cut(s) 323
BbvI GCAGC 3 cut(s) 101, 104, 107
BcgI CGANNNNNNTGC 2 cut(s) 127, 161
BisI GCNGC 5 cut(s) 90, 93, 96, 246, 405
BlsI GCNGC 5 cut(s) 91, 94, 97, 247, 406
BmgT120I GGNCC 1 cut(s) 324
BpiI GAAGAC 1 cut(s) 323
Bpu14I TTCGAA 1 cut(s) 413
BsaJI CCNNGG 1 cut(s) 246
BsaXI ACNNNNNCTCC 2 cut(s) 124, 154
BseDI CCNNGG 1 cut(s) 246
BseMII CTCAG 1 cut(s) 288
BseXI GCAGC 3 cut(s) 101, 104, 107
BsgI GTGCAG 1 cut(s) 157
Bsh1236I CGCG 1 cut(s) 248
BshFI GGCC 2 cut(s) 245, 326
BsiSI CCGG 1 cut(s) 159
BsnI GGCC 2 cut(s) 245, 326
Bsp119I TTCGAA 1 cut(s) 413
BspACI CCGC 4 cut(s) 246, 248, 404, 407
BspANI GGCC 2 cut(s) 245, 326
BspCNI CTCAG 1 cut(s) 289
BspFNI CGCG 1 cut(s) 248
BspT104I TTCGAA 1 cut(s) 413
BssECI CCNNGG 1 cut(s) 246
BstBI TTCGAA 1 cut(s) 413
BstC8I GCNNGC 3 cut(s) 87, 243, 402
BstDEI CTNAG 1 cut(s) 297
BstDSI CCRYGG 1 cut(s) 246
BstFNI CGCG 1 cut(s) 248
BstMWI GCNNNNNNNGC 2 cut(s) 82, 95
BstNSI RCATGY 1 cut(s) 241
BstUI CGCG 1 cut(s) 248
BstV1I GCAGC 3 cut(s) 101, 104, 107
BstV2I GAAGAC 1 cut(s) 323
BsuRI GGCC 2 cut(s) 245, 326
BtgI CCRYGG 1 cut(s) 246
BtsI GCAGTG 1 cut(s) 145
BtsIMutI CAGTG 1 cut(s) 145
Cac8I GCNNGC 3 cut(s) 87, 243, 402
Cfr13I GGNCC 1 cut(s) 324
Cfr42I CCGCGG 1 cut(s) 249
CviAII CATG 1 cut(s) 238
CviJI RGCY 7 cut(s) 85, 189, 217, 245, 296, 326, 400
CviKI_1 RGCY 7 cut(s) 85, 189, 217, 245, 296, 326, 400
DdeI CTNAG 1 cut(s) 297
EaeI YGGCCR 1 cut(s) 243
FaeI CATG 1 cut(s) 241
FaiI YATR 3 cut(s) 10, 239, 365
FatI CATG 1 cut(s) 237
Fnu4HI GCNGC 5 cut(s) 90, 93, 96, 246, 405
Fsp4HI GCNGC 5 cut(s) 90, 93, 96, 246, 405
GluI GCNGC 5 cut(s) 90, 93, 96, 246, 405
HaeIII GGCC 2 cut(s) 245, 326
HapII CCGG 1 cut(s) 159
Hin1II CATG 1 cut(s) 241
HinfI GANTC 4 cut(s) 71, 275, 379, 410
HpaII CCGG 1 cut(s) 159
Hpy188I TCNGA 1 cut(s) 292
Hpy99I CGWCG 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 200
HpyCH4V TGCA 1 cut(s) 138
HpyF10VI GCNNNNNNNGC 2 cut(s) 82, 95
HpyF3I CTNAG 1 cut(s) 297
Hsp92II CATG 1 cut(s) 241
KspI CCGCGG 1 cut(s) 249
LpnPI CCDG 3 cut(s) 172, 227, 344
Lsp1109I GCAGC 3 cut(s) 101, 104, 107
MboII GAAGA 3 cut(s) 184, 187, 328
MluCI AATT 4 cut(s) 66, 211, 280, 302
MseI TTAA 1 cut(s) 30
MspA1I CMGCKG 1 cut(s) 248
MspI CCGG 1 cut(s) 159
MvnI CGCG 1 cut(s) 248
MwoI GCNNNNNNNGC 2 cut(s) 82, 95
NlaIII CATG 1 cut(s) 241
NspI RCATGY 1 cut(s) 241
NspV TTCGAA 1 cut(s) 413
PfeI GAWTC 4 cut(s) 71, 275, 379, 410
PkrI GCNGC 5 cut(s) 91, 94, 97, 247, 406
PspPI GGNCC 1 cut(s) 324
SacII CCGCGG 1 cut(s) 249
SaqAI TTAA 1 cut(s) 30
SatI GCNGC 5 cut(s) 90, 93, 96, 246, 405
Sau96I GGNCC 1 cut(s) 324
SetI ASST 5 cut(s) 108, 137, 191, 211, 298
Sfr303I CCGCGG 1 cut(s) 249
SfuI TTCGAA 1 cut(s) 413
SgrBI CCGCGG 1 cut(s) 249
Sse9I AATT 4 cut(s) 66, 211, 280, 302
SsiI CCGC 4 cut(s) 246, 248, 404, 407
TaqI TCGA 4 cut(s) 80, 112, 198, 413
TasI AATT 4 cut(s) 66, 211, 280, 302
TauI GCSGC 2 cut(s) 248, 407
TfiI GAWTC 4 cut(s) 71, 275, 379, 410
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TscAI CASTG 1 cut(s) 145
TseI GCWGC 3 cut(s) 89, 92, 95
TspGWI ACGGA 2 cut(s) 145, 187
TspRI CASTG 1 cut(s) 145
XapI RAATTY 1 cut(s) 302
XceI RCATGY 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.