Rmu_co8195526.1_g000001

AP2-like ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8195526.1
Physical Location & Seq
Forward (+)
1 .. 258
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8195526.1_g000001.1.cds

Sequence Viewer

Length: 258 bp
tccatggccaggactcagctcgcttgcgccgagtttacgggtcactcggttgagtcgattgggaacgagttgggtttctcgagctgtggtgcaacgaacacgagcaatgctttgtctcttggggtcactaatacgaatgctaatactcagacctcgaatcgtgaaaaggctgttgttgcggtggacactgatagcgctaagaaaatatctgatacttttgggcagaggacttcaatttacagaggagttactaggtaa

Protein Analysis

85

Amino Acids

8.9

Weight (kDa)

7.79

Isoelectric Point (pI)

4.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 179
AcoI YGGCCR 1 cut(s) 6
AfeI AGCGCT 1 cut(s) 196
AfiI CCNNNNNNNGG 1 cut(s) 9
AgsI TTSAA 1 cut(s) 234
AjnI CCWGG 1 cut(s) 8
AluBI AGCT 2 cut(s) 19, 84
AluI AGCT 2 cut(s) 19, 84
Alw26I GTCTC 1 cut(s) 120
Ama87I CYCGRG 1 cut(s) 79
Aor51HI AGCGCT 1 cut(s) 196
AoxI GGCC 1 cut(s) 6
AspLEI GCGC 2 cut(s) 29, 197
AvaI CYCGRG 1 cut(s) 79
BalI TGGCCA 1 cut(s) 8
BauI CACGAG 1 cut(s) 100
BciT130I CCWGG 1 cut(s) 10
BcoDI GTCTC 1 cut(s) 120
BfaI CTAG 1 cut(s) 252
BfoI RGCGCY 1 cut(s) 198
Bme1390I CCNGG 1 cut(s) 10
BmeT110I CYCGRG 1 cut(s) 79
BmrFI CCNGG 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 3
Bsc4I CCNNNNNNNGG 1 cut(s) 9
Bse3DI GCAATG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 10
BseDI CCNNGG 1 cut(s) 3
BseLI CCNNNNNNNGG 1 cut(s) 9
BseMI GCAATG 1 cut(s) 112
BseMII CTCAG 2 cut(s) 29, 161
BseRI GAGGAG 1 cut(s) 258
BshFI GGCC 1 cut(s) 8
BsiHKCI CYCGRG 1 cut(s) 79
BslI CCNNNNNNNGG 1 cut(s) 9
BsmAI GTCTC 1 cut(s) 120
BsmI GAATGC 1 cut(s) 142
BsnI GGCC 1 cut(s) 8
BsoBI CYCGRG 1 cut(s) 79
Bsp19I CCATGG 1 cut(s) 3
BspACI CCGC 1 cut(s) 179
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 2 cut(s) 28, 160
BsrDI GCAATG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 3
BssSI CACGAG 1 cut(s) 100
BssT1I CCWWGG 1 cut(s) 3
Bst2BI CACGAG 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 10
BstC8I GCNNGC 2 cut(s) 21, 25
BstDEI CTNAG 3 cut(s) 15, 147, 198
BstDSI CCRYGG 1 cut(s) 3
BstH2I RGCGCY 1 cut(s) 198
BstHHI GCGC 2 cut(s) 29, 197
BstMAI GTCTC 1 cut(s) 120
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstNI CCWGG 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 8
BsuRI GGCC 1 cut(s) 8
BtgI CCRYGG 1 cut(s) 3
BtsIMutI CAGTG 1 cut(s) 186
Cac8I GCNNGC 2 cut(s) 21, 25
CfoI GCGC 2 cut(s) 29, 197
CviAII CATG 1 cut(s) 4
CviJI RGCY 4 cut(s) 8, 19, 84, 170
CviKI_1 RGCY 4 cut(s) 8, 19, 84, 170
DdeI CTNAG 3 cut(s) 15, 147, 198
EaeI YGGCCR 1 cut(s) 6
Eco130I CCWWGG 1 cut(s) 3
Eco47III AGCGCT 1 cut(s) 196
Eco88I CYCGRG 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 8
EcoT14I CCWWGG 1 cut(s) 3
ErhI CCWWGG 1 cut(s) 3
FaeI CATG 1 cut(s) 7
FaiI YATR 1 cut(s) 5
FatI CATG 1 cut(s) 3
FspBI CTAG 1 cut(s) 252
GlaI GCGC 2 cut(s) 28, 196
HaeII RGCGCY 1 cut(s) 198
HaeIII GGCC 1 cut(s) 8
HhaI GCGC 2 cut(s) 29, 197
Hin1II CATG 1 cut(s) 7
Hin6I GCGC 2 cut(s) 27, 195
HinP1I GCGC 2 cut(s) 27, 195
HinfI GANTC 3 cut(s) 13, 53, 157
Hpy166II GTNNAC 2 cut(s) 36, 184
Hpy188I TCNGA 2 cut(s) 150, 211
Hpy188III TCNNGA 2 cut(s) 79, 161
Hpy8I GTNNAC 2 cut(s) 36, 184
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
HpyF3I CTNAG 3 cut(s) 15, 147, 198
Hsp92II CATG 1 cut(s) 7
HspAI GCGC 2 cut(s) 27, 195
LpnPI CCDG 1 cut(s) 22
MaeI CTAG 1 cut(s) 252
MaeIII GTNAC 3 cut(s) 41, 124, 247
MlsI TGGCCA 1 cut(s) 8
MluCI AATT 1 cut(s) 234
MluNI TGGCCA 1 cut(s) 8
MlyI GAGTC 2 cut(s) 7, 62
MnlI CCTC 3 cut(s) 163, 219, 236
Mox20I TGGCCA 1 cut(s) 8
MscI TGGCCA 1 cut(s) 8
Msp20I TGGCCA 1 cut(s) 8
MspR9I CCNGG 1 cut(s) 10
Mva1269I GAATGC 1 cut(s) 142
MvaI CCWGG 1 cut(s) 10
MwoI GCNNNNNNNGC 1 cut(s) 176
NcoI CCATGG 1 cut(s) 3
NlaIII CATG 1 cut(s) 7
NmeAIII GCCGAG 1 cut(s) 55
NmuCI GTSAC 2 cut(s) 41, 124
PaeR7I CTCGAG 1 cut(s) 79
PcsI WCGNNNNNNNCGW 2 cut(s) 27, 53
PctI GAATGC 1 cut(s) 142
PfeI GAWTC 1 cut(s) 157
PleI GAGTC 2 cut(s) 7, 61
PpsI GAGTC 2 cut(s) 7, 61
Psp6I CCWGG 1 cut(s) 8
PspGI CCWGG 1 cut(s) 8
SchI GAGTC 2 cut(s) 7, 62
ScrFI CCNGG 1 cut(s) 10
SetI ASST 4 cut(s) 21, 86, 155, 257
Sfr274I CTCGAG 1 cut(s) 79
SlaI CTCGAG 1 cut(s) 79
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
Sse9I AATT 1 cut(s) 234
SsiI CCGC 1 cut(s) 179
SspMI CTAG 1 cut(s) 252
StyD4I CCNGG 1 cut(s) 8
StyI CCWWGG 1 cut(s) 3
TaqI TCGA 3 cut(s) 56, 80, 155
TasI AATT 1 cut(s) 234
TfiI GAWTC 1 cut(s) 157
TscAI CASTG 1 cut(s) 193
TseFI GTSAC 2 cut(s) 41, 124
Tsp45I GTSAC 2 cut(s) 41, 124
TspRI CASTG 1 cut(s) 193
XhoI CTCGAG 1 cut(s) 79
XspI CTAG 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.