Rmu_co8264225.1_g000001

Bifunctional purine biosynthesis protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8264225.1
OG0002841
Physical Location & Seq
Forward (+)
1 .. 585
585 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8264225.1_g000001.1.cds

Sequence Viewer

Length: 338 bp
gtacattcgatgtggttgtggtgaatttatatcccttttatgataaagttacttcaaagggaggaatagaatttgaggatggaatcgagaatatagatattggtggtcctgccatgattagagctgctgcaaagaatcacaaagatgtcctggtggttgttgattcagaagactatcctgcactgctagaatatcttaaagcagacaaggatgatcaacaattccgaagaaaccttgcgtggaaggcttttcaacatgttgcttcttatgattctgctgtttcagagtggctgtggaggcagactaccgaaggtacttctttgggtgctaatatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00230 ko00670 ko01100 ko01110 ko01130 ko01523 map00230 map00670 map01100 map01110 map01130 map01523
Pfam Domains
Protein Families
AICARFT_IMPCHas MGS

Protein Analysis

111

Amino Acids

12.48

Weight (kDa)

4.64

Isoelectric Point (pI)

60.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 24, 70
AfaI GTAC 2 cut(s) 3, 315
AflIII ACRYGT 1 cut(s) 255
AgsI TTSAA 2 cut(s) 56, 253
AjnI CCWGG 1 cut(s) 149
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
ApeKI GCWGC 2 cut(s) 124, 127
ApoI RAATTY 2 cut(s) 24, 70
AspS9I GGNCC 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 33
AvaII GGWCC 1 cut(s) 106
BbsI GAAGAC 1 cut(s) 176
BbvI GCAGC 2 cut(s) 111, 114
BccI CCATC 1 cut(s) 73
BciT130I CCWGG 1 cut(s) 151
BclI TGATCA 1 cut(s) 213
BfaI CTAG 1 cut(s) 187
BisI GCNGC 2 cut(s) 125, 128
BlsI GCNGC 2 cut(s) 126, 129
Bme1390I CCNGG 1 cut(s) 151
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmrFI CCNGG 1 cut(s) 151
BpiI GAAGAC 1 cut(s) 176
BseBI CCWGG 1 cut(s) 151
BseGI GGATG 2 cut(s) 84, 216
BseXI GCAGC 2 cut(s) 111, 114
BsgI GTGCAG 1 cut(s) 164
Bsp143I GATC 1 cut(s) 213
BssMI GATC 1 cut(s) 213
Bst2UI CCWGG 1 cut(s) 151
BstF5I GGATG 2 cut(s) 84, 216
BstKTI GATC 1 cut(s) 216
BstMBI GATC 1 cut(s) 213
BstMWI GCNNNNNNNGC 2 cut(s) 244, 297
BstNI CCWGG 1 cut(s) 151
BstNSI RCATGY 1 cut(s) 259
BstSCI CCNGG 1 cut(s) 149
BstV1I GCAGC 2 cut(s) 111, 114
BstV2I GAAGAC 1 cut(s) 176
BtsCI GGATG 2 cut(s) 84, 216
BtsI GCAGTG 1 cut(s) 181
BtsIMutI CAGTG 1 cut(s) 181
Cfr13I GGNCC 1 cut(s) 106
Csp6I GTAC 2 cut(s) 2, 314
CviAII CATG 2 cut(s) 114, 256
CviJI RGCY 3 cut(s) 124, 247, 291
CviKI_1 RGCY 3 cut(s) 124, 247, 291
CviQI GTAC 2 cut(s) 2, 314
DpnI GATC 1 cut(s) 215
DpnII GATC 1 cut(s) 213
Eco47I GGWCC 1 cut(s) 106
EcoRII CCWGG 1 cut(s) 149
FaeI CATG 2 cut(s) 117, 259
FaiI YATR 6 cut(s) 30, 41, 94, 115, 257, 269
FatI CATG 2 cut(s) 113, 255
FbaI TGATCA 1 cut(s) 213
Fnu4HI GCNGC 2 cut(s) 125, 128
FokI GGATG 2 cut(s) 91, 223
Fsp4HI GCNGC 2 cut(s) 125, 128
FspBI CTAG 1 cut(s) 187
GluI GCNGC 2 cut(s) 125, 128
Hin1II CATG 2 cut(s) 117, 259
HinfI GANTC 4 cut(s) 83, 135, 163, 271
HphI GGTGA 1 cut(s) 33
Hpy188I TCNGA 3 cut(s) 168, 226, 285
Hpy188III TCNNGA 1 cut(s) 87
HpyAV CCTTC 2 cut(s) 237, 304
HpyCH4V TGCA 2 cut(s) 130, 181
HpyF10VI GCNNNNNNNGC 2 cut(s) 244, 297
Hsp92II CATG 2 cut(s) 117, 259
Ksp22I TGATCA 1 cut(s) 213
Kzo9I GATC 1 cut(s) 213
LpnPI CCDG 4 cut(s) 122, 136, 163, 191
Lsp1109I GCAGC 2 cut(s) 111, 114
MaeI CTAG 1 cut(s) 187
MaeIII GTNAC 1 cut(s) 48
MalI GATC 1 cut(s) 215
MboI GATC 1 cut(s) 213
MboII GAAGA 2 cut(s) 181, 239
MluCI AATT 3 cut(s) 24, 70, 220
MnlI CCTC 3 cut(s) 55, 69, 290
MseI TTAA 2 cut(s) 197, 336
MslI CAYNNNNRTG 1 cut(s) 143
MspR9I CCNGG 1 cut(s) 151
MvaI CCWGG 1 cut(s) 151
MwoI GCNNNNNNNGC 2 cut(s) 244, 297
NdeII GATC 1 cut(s) 213
NlaIII CATG 2 cut(s) 117, 259
NspI RCATGY 1 cut(s) 259
PciI ACATGT 1 cut(s) 255
PfeI GAWTC 4 cut(s) 83, 135, 163, 271
PkrI GCNGC 2 cut(s) 126, 129
PscI ACATGT 1 cut(s) 255
Psp6I CCWGG 1 cut(s) 149
PspGI CCWGG 1 cut(s) 149
PspPI GGNCC 1 cut(s) 106
RsaI GTAC 2 cut(s) 3, 315
RsaNI GTAC 2 cut(s) 2, 314
RseI CAYNNNNRTG 1 cut(s) 143
SaqAI TTAA 2 cut(s) 197, 336
SatI GCNGC 2 cut(s) 125, 128
Sau3AI GATC 1 cut(s) 213
Sau96I GGNCC 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 151
SetI ASST 3 cut(s) 126, 236, 315
SinI GGWCC 1 cut(s) 106
SmiMI CAYNNNNRTG 1 cut(s) 143
Sse9I AATT 3 cut(s) 24, 70, 220
SspI AATATT 1 cut(s) 333
SspMI CTAG 1 cut(s) 187
StyD4I CCNGG 1 cut(s) 149
TaqI TCGA 2 cut(s) 8, 86
TasI AATT 3 cut(s) 24, 70, 220
TfiI GAWTC 4 cut(s) 83, 135, 163, 271
Tru1I TTAA 2 cut(s) 197, 336
Tru9I TTAA 2 cut(s) 197, 336
TscAI CASTG 1 cut(s) 188
TseI GCWGC 2 cut(s) 124, 127
TspRI CASTG 1 cut(s) 188
VpaK11BI GGWCC 1 cut(s) 106
XapI RAATTY 2 cut(s) 24, 70
XceI RCATGY 1 cut(s) 259
XspI CTAG 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.