Rroxscaffold_4G00323570

Bifunctional purine biosynthesis protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
54408113 .. 54412695
4583 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00323570.1

Sequence Viewer

Length: 183 bp
ATGGAAGCTCTTAGTAATCACGGAATTGGTACATTCGATGTGGTTGTGGTGAATTTATATCCCTTTTATGATAAAGTTACTTCAAAGGGAGGAATAGAATTTGAGGATGGAATCGAGAATATAGATATTGGTGGTCCTGCCATGATTAGAGCTGCTGCAAAGAAGACTATCATGCACTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.49

Weight (kDa)

5.04

Isoelectric Point (pI)

57.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 52, 98
AfaI GTAC 1 cut(s) 31
AgsI TTSAA 1 cut(s) 84
AluBI AGCT 2 cut(s) 8, 152
AluI AGCT 2 cut(s) 8, 152
ApeKI GCWGC 2 cut(s) 152, 155
ApoI RAATTY 2 cut(s) 52, 98
AspS9I GGNCC 1 cut(s) 134
AsuHPI GGTGA 1 cut(s) 61
AvaII GGWCC 1 cut(s) 134
BbsI GAAGAC 1 cut(s) 170
BbvI GCAGC 2 cut(s) 139, 142
BccI CCATC 1 cut(s) 101
BfaI CTAG 1 cut(s) 181
BisI GCNGC 2 cut(s) 153, 156
BlsI GCNGC 2 cut(s) 154, 157
Bme18I GGWCC 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 134
BpiI GAAGAC 1 cut(s) 170
BseGI GGATG 1 cut(s) 112
BseXI GCAGC 2 cut(s) 139, 142
BstDEI CTNAG 1 cut(s) 11
BstF5I GGATG 1 cut(s) 112
BstV1I GCAGC 2 cut(s) 139, 142
BstV2I GAAGAC 1 cut(s) 170
BtsCI GGATG 1 cut(s) 112
BtsI GCAGTG 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 134
Csp6I GTAC 1 cut(s) 30
CviAII CATG 2 cut(s) 142, 172
CviJI RGCY 2 cut(s) 8, 152
CviKI_1 RGCY 2 cut(s) 8, 152
CviQI GTAC 1 cut(s) 30
DdeI CTNAG 1 cut(s) 11
Eco47I GGWCC 1 cut(s) 134
FaeI CATG 2 cut(s) 145, 175
FaiI YATR 5 cut(s) 58, 69, 122, 143, 173
FatI CATG 2 cut(s) 141, 171
Fnu4HI GCNGC 2 cut(s) 153, 156
FokI GGATG 1 cut(s) 119
Fsp4HI GCNGC 2 cut(s) 153, 156
FspBI CTAG 1 cut(s) 181
GluI GCNGC 2 cut(s) 153, 156
Hin1II CATG 2 cut(s) 145, 175
HinfI GANTC 1 cut(s) 111
HphI GGTGA 1 cut(s) 61
Hpy188III TCNNGA 1 cut(s) 115
HpyCH4V TGCA 2 cut(s) 158, 175
HpyF3I CTNAG 1 cut(s) 11
Hsp92II CATG 2 cut(s) 145, 175
LpnPI CCDG 1 cut(s) 150
Lsp1109I GCAGC 2 cut(s) 139, 142
MaeI CTAG 1 cut(s) 181
MaeIII GTNAC 1 cut(s) 76
MboII GAAGA 1 cut(s) 175
MluCI AATT 3 cut(s) 24, 52, 98
MnlI CCTC 2 cut(s) 83, 97
NlaIII CATG 2 cut(s) 145, 175
PfeI GAWTC 1 cut(s) 111
PkrI GCNGC 2 cut(s) 154, 157
PspPI GGNCC 1 cut(s) 134
RsaI GTAC 1 cut(s) 31
RsaNI GTAC 1 cut(s) 30
SatI GCNGC 2 cut(s) 153, 156
Sau96I GGNCC 1 cut(s) 134
SetI ASST 2 cut(s) 10, 154
SgeI CNNG 4 cut(s) 32, 127, 149, 154
SinI GGWCC 1 cut(s) 134
Sse9I AATT 3 cut(s) 24, 52, 98
SspMI CTAG 1 cut(s) 181
TaqI TCGA 2 cut(s) 36, 114
TasI AATT 3 cut(s) 24, 52, 98
TfiI GAWTC 1 cut(s) 111
TscAI CASTG 1 cut(s) 182
TseI GCWGC 2 cut(s) 152, 155
TspGWI ACGGA 1 cut(s) 36
TspRI CASTG 1 cut(s) 182
VpaK11BI GGWCC 1 cut(s) 134
XapI RAATTY 2 cut(s) 52, 98
XspI CTAG 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.