Rh6AG033400

Bifunctional purine biosynthesis protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0002841
Physical Location & Seq
Forward (+)
4229871 .. 4246836
16966 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG033400.1

Sequence Viewer

Length: 195 bp
ATGAATTTCCAGGAAATTTCCTTCAACAATAACTCCATGTGGAGTTTGGAAGACAAAAATATATGCGAGCGATCATCATGTGATGATATACTTGAAGCATACAGGCTTGCTGTCAAAGCAGATCCAGTGAGTGCATTTGGTGGCATTGTAGCTTTCAACATAGAGGTTGATGAGGCTCTTGATAAAGAAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00230 ko00670 ko01100 ko01110 ko01130 ko01523 map00230 map00670 map01100 map01110 map01130 map01523
Pfam Domains
Protein Families
AICARFT_IMPCHas MGS

Protein Analysis

64

Amino Acids

7.22

Weight (kDa)

4.08

Isoelectric Point (pI)

53.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AICARFT_IMPCHas PF01808 8 - 64 1.1e-11 AICARFT/IMPCHase bienzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 116
AcsI RAATTY 2 cut(s) 4, 15
AgsI TTSAA 3 cut(s) 25, 95, 157
AjnI CCWGG 1 cut(s) 9
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
AlwI GGATC 1 cut(s) 116
ApoI RAATTY 2 cut(s) 4, 15
BbsI GAAGAC 1 cut(s) 57
BciT130I CCWGG 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 11
BpiI GAAGAC 1 cut(s) 57
BsaXI ACNNNNNCTCC 2 cut(s) 17, 47
Bse1I ACTGG 1 cut(s) 125
BseBI CCWGG 1 cut(s) 11
BseNI ACTGG 1 cut(s) 125
Bsp143I GATC 2 cut(s) 71, 121
BspPI GGATC 1 cut(s) 116
BsrI ACTGG 1 cut(s) 125
BssMI GATC 2 cut(s) 71, 121
Bst2UI CCWGG 1 cut(s) 11
BstC8I GCNNGC 2 cut(s) 68, 108
BstKTI GATC 2 cut(s) 74, 124
BstMBI GATC 2 cut(s) 71, 121
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstNI CCWGG 1 cut(s) 11
BstSCI CCNGG 1 cut(s) 9
BstV2I GAAGAC 1 cut(s) 57
BstX2I RGATCY 1 cut(s) 121
BstYI RGATCY 1 cut(s) 121
BtsIMutI CAGTG 1 cut(s) 132
Cac8I GCNNGC 2 cut(s) 68, 108
CviAII CATG 2 cut(s) 37, 78
CviJI RGCY 3 cut(s) 106, 152, 176
CviKI_1 RGCY 3 cut(s) 106, 152, 176
DpnI GATC 2 cut(s) 73, 123
DpnII GATC 2 cut(s) 71, 121
EcoRII CCWGG 1 cut(s) 9
FaeI CATG 2 cut(s) 40, 81
FaiI YATR 7 cut(s) 38, 62, 64, 79, 89, 100, 161
FatI CATG 2 cut(s) 36, 77
Hin1II CATG 2 cut(s) 40, 81
Hpy188I TCNGA 1 cut(s) 194
Hpy188III TCNNGA 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
Hsp92II CATG 2 cut(s) 40, 81
Kzo9I GATC 2 cut(s) 71, 121
LpnPI CCDG 3 cut(s) 23, 88, 138
MalI GATC 2 cut(s) 73, 123
MboI GATC 2 cut(s) 71, 121
MboII GAAGA 1 cut(s) 62
MflI RGATCY 1 cut(s) 121
MluCI AATT 2 cut(s) 4, 15
MnlI CCTC 2 cut(s) 157, 166
MspR9I CCNGG 1 cut(s) 11
MvaI CCWGG 1 cut(s) 11
MwoI GCNNNNNNNGC 1 cut(s) 116
NdeII GATC 2 cut(s) 71, 121
NlaIII CATG 2 cut(s) 40, 81
PfoI TCCNGGA 1 cut(s) 9
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
PsuI RGATCY 1 cut(s) 121
Sau3AI GATC 2 cut(s) 71, 121
ScrFI CCNGG 1 cut(s) 11
SetI ASST 2 cut(s) 154, 168
Sse9I AATT 2 cut(s) 4, 15
StyD4I CCNGG 1 cut(s) 9
TasI AATT 2 cut(s) 4, 15
TscAI CASTG 1 cut(s) 132
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 132
XapI RAATTY 2 cut(s) 4, 15
XcmI CCANNNNNNNNNTGG 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.