Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8299443.1

Orthogroup ID

OG0003420

Physical Location & Seq

Genomic Coordinates Reverse (-)

171 .. 830

Gene Structure 660 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8299443.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 660 bp

atggttgaagttctccaaaacactcccaaacggagaggatctagaaaatttggcaaatgtcccacactgagcagttgcacagttgaatacttgtttgagacagaaagaattgagttagatatgttagtcgttacacatgcttctctcctaaagctttttgatattgctgatacatggatcttttcggaaatattgactgaattaaggattttccatgagaagttggtttcattgatcaattcattgtcacaggaaaacaacaagtttctcattaaggtatcaaatacaaagaatatattgccaactgatcactttgagttgaacaccaacttcacattcacttcccctatcccccaaccaatactggaggataacaggaggaggaatgtggtggagagagtaaaccatgacatgagcttgatcatccagtgcatgcttatgaaggtaatgaaacccagtataggttttggacagatggataggcagaagctagcaattgcagcaattgaaaagtgtattgggttagaaaaattcaggtttgttccaacaagagcagctgttggtgtcagcattgcaagtctgatcaagaacgagtatttgctggtggataagaacgacaacaacatcagtctttgtacccccttcaccctctccggctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04110 ko04111 ko04114 ko04120 ko04141 ko04310 ko04340 ko04341 ko04350 ko04710 ko05168 ko05200 map04110 map04111 map04114 map04120 map04141 map04310 map04340 map04341 map04350 map04710 map05168 map05200

Pfam Domains

Protein Families

Cullin Cullin_Nedd8

Protein Analysis

219

Amino Acids

25.01

Weight (kDa)

8.59

Isoelectric Point (pI)

48.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003420)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G28840 AT5G28840
fragaria_vesca	FvH4_6g02980
malus_domestica	MD04G1224100.v1.1 MD04G1224200.v1.1 MD12G1240900.v1.1
prunus_persica	Prupe.1G025100_v2.0.a1 Prupe.1G025100_v2.0.a1 Prupe.6G342800_v2.0.a1
pyrus_communis	pycom04g19750
rosa_chinensis	RchiOBHm_Chr3g0451161 RchiOBHm_Chr4g0388911
rosa_laevigata	RLG00000010008 RLG00000010011 RLG00000025681 RLG00000025682
rosa_multiflora	Rmu_co8299443.1_g000001 Rmu_sc0005486.1_g000010 Rmu_ssc0000028.1_g000003
rosa_roxburghii	Rroxscaffold_5G00335220 Rroxscaffold_6G00428630
rosa_rugosa	Rorug02G0632400 Rorug02G0632500 Rorug03G0321000 Rorug03G0321000 Rorug03G0321100
rosa_samantha	Rh3AG034900 Rh3BG035300 Rh3CG033800 Rh3CG033900 Rh3DG034900 Rh4BG018800 Rh4CG028600 Rh4DG019300
rosa_wichuraiana	Rw3G002560 Rw4G001840

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	46, 185
AcsI	RAATTY	2 cut(s)	47, 530
AfaI	GTAC	1 cut(s)	637
AfiI	CCNNNNNNNGG	1 cut(s)	461
AgsI	TTSAA	4 cut(s)	8, 86, 322, 509
AjuI	GAANNNNNNNTTGG	4 cut(s)	320, 352, 501, 533
AluBI	AGCT	4 cut(s)	154, 417, 490, 557
AluI	AGCT	4 cut(s)	154, 417, 490, 557
Alw26I	GTCTC	1 cut(s)	92
AlwI	GGATC	2 cut(s)	46, 185
ApeKI	GCWGC	2 cut(s)	500, 554
ApoI	RAATTY	2 cut(s)	47, 530
AsuHPI	GGTGA	1 cut(s)	637
AsuNHI	GCTAGC	1 cut(s)	490
BbvI	GCAGC	2 cut(s)	512, 566
BccI	CCATC	1 cut(s)	469
BclI	TGATCA	4 cut(s)	234, 307, 420, 582
BcoDI	GTCTC	1 cut(s)	92
BfaI	CTAG	2 cut(s)	42, 491
BisI	GCNGC	2 cut(s)	501, 555
BlsI	GCNGC	2 cut(s)	502, 556
BmrI	ACTGGG	1 cut(s)	450
BmtI	GCTAGC	1 cut(s)	494
BmuI	ACTGGG	1 cut(s)	450
BpmI	CTGGAG	1 cut(s)	386
Bsc4I	CCNNNNNNNGG	1 cut(s)	461
Bse1I	ACTGG	3 cut(s)	369, 427, 456
Bse3DI	GCAATG	1 cut(s)	570
BseGI	GGATG	1 cut(s)	423
BseLI	CCNNNNNNNGG	1 cut(s)	461
BseMI	GCAATG	1 cut(s)	570
BseMII	CTCAG	1 cut(s)	59
BseNI	ACTGG	3 cut(s)	369, 427, 456
BseRI	GAGGAG	1 cut(s)	394
BseXI	GCAGC	2 cut(s)	512, 566
BsiSI	CCGG	1 cut(s)	654
BslFI	GGGAC	1 cut(s)	45
BslI	CCNNNNNNNGG	1 cut(s)	461
BsmAI	GTCTC	1 cut(s)	92
BsmFI	GGGAC	1 cut(s)	45
Bsp143I	GATC	6 cut(s)	38, 177, 234, 307, 420, 582
BspCNI	CTCAG	1 cut(s)	60
BspOI	GCTAGC	1 cut(s)	494
BspPI	GGATC	2 cut(s)	46, 185
BsrDI	GCAATG	1 cut(s)	570
BsrI	ACTGG	3 cut(s)	369, 427, 456
BssMI	GATC	6 cut(s)	38, 177, 234, 307, 420, 582
Bst4CI	ACNGT	1 cut(s)	82
BstC8I	GCNNGC	2 cut(s)	434, 492
BstDEI	CTNAG	1 cut(s)	68
BstF5I	GGATG	1 cut(s)	423
BstKTI	GATC	6 cut(s)	41, 180, 237, 310, 423, 585
BstMAI	GTCTC	1 cut(s)	92
BstMBI	GATC	6 cut(s)	38, 177, 234, 307, 420, 582
BstMWI	GCNNNNNNNGC	1 cut(s)	500
BstNSI	RCATGY	2 cut(s)	140, 436
BstV1I	GCAGC	2 cut(s)	512, 566
BstX2I	RGATCY	2 cut(s)	38, 177
BstYI	RGATCY	2 cut(s)	38, 177
BtsCI	GGATG	1 cut(s)	423
BtsIMutI	CAGTG	2 cut(s)	65, 434
Cac8I	GCNNGC	2 cut(s)	434, 492
Csp6I	GTAC	1 cut(s)	636
CviAII	CATG	6 cut(s)	137, 174, 215, 407, 412, 433
CviJI	RGCY	5 cut(s)	154, 417, 490, 557, 657
CviKI_1	RGCY	5 cut(s)	154, 417, 490, 557, 657
CviQI	GTAC	1 cut(s)	636
DdeI	CTNAG	1 cut(s)	68
DpnI	GATC	6 cut(s)	40, 179, 236, 309, 422, 584
DpnII	GATC	6 cut(s)	38, 177, 234, 307, 420, 582
FaeI	CATG	6 cut(s)	140, 177, 218, 410, 415, 436
FaqI	GGGAC	1 cut(s)	45
FatI	CATG	6 cut(s)	136, 173, 214, 406, 411, 432
FbaI	TGATCA	4 cut(s)	234, 307, 420, 582
Fnu4HI	GCNGC	2 cut(s)	501, 555
FokI	GGATG	1 cut(s)	410
Fsp4HI	GCNGC	2 cut(s)	501, 555
FspBI	CTAG	2 cut(s)	42, 491
GluI	GCNGC	2 cut(s)	501, 555
GsuI	CTGGAG	1 cut(s)	386
HapII	CCGG	1 cut(s)	654
Hin1II	CATG	6 cut(s)	140, 177, 218, 410, 415, 436
HindIII	AAGCTT	1 cut(s)	152
HpaII	CCGG	1 cut(s)	654
HphI	GGTGA	1 cut(s)	637
Hpy166II	GTNNAC	1 cut(s)	403
Hpy188I	TCNGA	2 cut(s)	187, 582
Hpy188III	TCNNGA	2 cut(s)	42, 586
Hpy8I	GTNNAC	1 cut(s)	403
HpyAV	CCTTC	2 cut(s)	436, 652
HpyCH4III	ACNGT	1 cut(s)	82
HpyCH4V	TGCA	4 cut(s)	78, 432, 500, 575
HpyF10VI	GCNNNNNNNGC	1 cut(s)	500
HpyF3I	CTNAG	1 cut(s)	68
Hsp92II	CATG	6 cut(s)	140, 177, 218, 410, 415, 436
Ksp22I	TGATCA	4 cut(s)	234, 307, 420, 582
Kzo9I	GATC	6 cut(s)	38, 177, 234, 307, 420, 582
LpnPI	CCDG	7 cut(s)	236, 350, 361, 440, 469, 520, 587
Lsp1109I	GCAGC	2 cut(s)	512, 566
MaeI	CTAG	2 cut(s)	42, 491
MaeIII	GTNAC	2 cut(s)	130, 246
MalI	GATC	6 cut(s)	40, 179, 236, 309, 422, 584
MboI	GATC	6 cut(s)	38, 177, 234, 307, 420, 582
MfeI	CAATTG	2 cut(s)	495, 504
MflI	RGATCY	2 cut(s)	38, 177
MluCI	AATT	7 cut(s)	47, 108, 200, 238, 495, 504, 530
MmeI	TCCRAC	1 cut(s)	569
MnlI	CCTC	5 cut(s)	29, 361, 372, 375, 659
MseI	TTAA	2 cut(s)	203, 273
MslI	CAYNNNNRTG	1 cut(s)	437
MspA1I	CMGCKG	1 cut(s)	557
MspI	CCGG	1 cut(s)	654
MunI	CAATTG	2 cut(s)	495, 504
MwoI	GCNNNNNNNGC	1 cut(s)	500
NdeII	GATC	6 cut(s)	38, 177, 234, 307, 420, 582
NheI	GCTAGC	1 cut(s)	490
NlaIII	CATG	6 cut(s)	140, 177, 218, 410, 415, 436
NmuCI	GTSAC	1 cut(s)	246
NspI	RCATGY	2 cut(s)	140, 436
PaeI	GCATGC	1 cut(s)	436
PkrI	GCNGC	2 cut(s)	502, 556
PsuI	RGATCY	2 cut(s)	38, 177
PvuII	CAGCTG	1 cut(s)	557
RsaI	GTAC	1 cut(s)	637
RsaNI	GTAC	1 cut(s)	636
RseI	CAYNNNNRTG	1 cut(s)	437
SaqAI	TTAA	2 cut(s)	203, 273
SatI	GCNGC	2 cut(s)	501, 555
Sau3AI	GATC	6 cut(s)	38, 177, 234, 307, 420, 582
SetI	ASST	8 cut(s)	156, 279, 419, 447, 466, 492, 539, 559
SmiMI	CAYNNNNRTG	1 cut(s)	437
SphI	GCATGC	1 cut(s)	436
Sse9I	AATT	7 cut(s)	47, 108, 200, 238, 495, 504, 530
SspI	AATATT	1 cut(s)	192
SspMI	CTAG	2 cut(s)	42, 491
TaaI	ACNGT	1 cut(s)	82
TasI	AATT	7 cut(s)	47, 108, 200, 238, 495, 504, 530
Tru1I	TTAA	2 cut(s)	203, 273
Tru9I	TTAA	2 cut(s)	203, 273
TscAI	CASTG	2 cut(s)	72, 434
TseFI	GTSAC	1 cut(s)	246
TseI	GCWGC	2 cut(s)	500, 554
Tsp45I	GTSAC	1 cut(s)	246
TspDTI	ATGAA	4 cut(s)	219, 231, 455, 464
TspGWI	ACGGA	1 cut(s)	46
TspRI	CASTG	2 cut(s)	72, 434
XapI	RAATTY	2 cut(s)	47, 530
XbaI	TCTAGA	1 cut(s)	41
XceI	RCATGY	2 cut(s)	140, 436
XspI	CTAG	2 cut(s)	42, 491

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.