Rmu_sc0005486.1_g000010

GDP-mannose 3,5-epimerase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005486.1
Physical Location & Seq
Forward (+)
45188 .. 46041
854 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005486.1_g000010.1.cds

Sequence Viewer

Length: 300 bp
atggataactgtttgaaggttactgctggtgttaaccatgttttcaaccttgctgctgacatgggaggtatggggttcattcagtccaaccattctgtcattatgtataacaacacaatgatcagctttaatatgctcgaggcagcaaggatcaatggagctaagaggttcttttatgcttctagtgcttgcatttaccctgaattcaaacagttggatactaatgtgagcttgaaggagtctgatgcttggcctgcagaggtttttactttcgcagaaagcttatgctataaaagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.04

Weight (kDa)

5.51

Isoelectric Point (pI)

35.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 158
AcsI RAATTY 1 cut(s) 203
AgsI TTSAA 4 cut(s) 16, 46, 208, 235
AluBI AGCT 4 cut(s) 126, 161, 231, 282
AluI AGCT 4 cut(s) 126, 161, 231, 282
AlwI GGATC 1 cut(s) 158
Ama87I CYCGRG 1 cut(s) 137
AoxI GGCC 1 cut(s) 251
ApeKI GCWGC 2 cut(s) 53, 143
ApoI RAATTY 1 cut(s) 203
AvaI CYCGRG 1 cut(s) 137
BaeI ACNNNNGTAYC 2 cut(s) 210, 243
BbvI GCAGC 2 cut(s) 40, 155
BciVI GTATCC 1 cut(s) 211
BclI TGATCA 1 cut(s) 120
BfaI CTAG 1 cut(s) 183
BfmI CTRYAG 1 cut(s) 255
BfuI GTATCC 1 cut(s) 211
BisI GCNGC 2 cut(s) 54, 144
BlsI GCNGC 2 cut(s) 55, 145
BmeT110I CYCGRG 1 cut(s) 137
BmsI GCATC 1 cut(s) 235
BseXI GCAGC 2 cut(s) 40, 155
BshFI GGCC 1 cut(s) 253
BsiHKCI CYCGRG 1 cut(s) 137
BsnI GGCC 1 cut(s) 253
BsoBI CYCGRG 1 cut(s) 137
Bsp143I GATC 2 cut(s) 120, 150
BspANI GGCC 1 cut(s) 253
BspMAI CTGCAG 1 cut(s) 259
BspPI GGATC 1 cut(s) 158
BssMI GATC 2 cut(s) 120, 150
Bst4CI ACNGT 2 cut(s) 11, 213
BstC8I GCNNGC 2 cut(s) 190, 255
BstDEI CTNAG 1 cut(s) 162
BstKTI GATC 2 cut(s) 123, 153
BstMBI GATC 2 cut(s) 120, 150
BstMWI GCNNNNNNNGC 2 cut(s) 185, 254
BstSFI CTRYAG 1 cut(s) 255
BstV1I GCAGC 2 cut(s) 40, 155
BsuI GTATCC 1 cut(s) 211
BsuRI GGCC 1 cut(s) 253
Cac8I GCNNGC 2 cut(s) 190, 255
CviAII CATG 2 cut(s) 38, 61
CviJI RGCY 5 cut(s) 126, 161, 231, 253, 282
CviKI_1 RGCY 5 cut(s) 126, 161, 231, 253, 282
DdeI CTNAG 1 cut(s) 162
DpnI GATC 2 cut(s) 122, 152
DpnII GATC 2 cut(s) 120, 150
Eco88I CYCGRG 1 cut(s) 137
EcoRI GAATTC 1 cut(s) 203
FaeI CATG 2 cut(s) 41, 64
FaiI YATR 9 cut(s) 39, 62, 71, 104, 108, 134, 177, 286, 291
FalI AAGNNNNNCTT 2 cut(s) 155, 187
FatI CATG 2 cut(s) 37, 60
FbaI TGATCA 1 cut(s) 120
Fnu4HI GCNGC 2 cut(s) 54, 144
Fsp4HI GCNGC 2 cut(s) 54, 144
FspBI CTAG 1 cut(s) 183
GluI GCNGC 2 cut(s) 54, 144
HaeIII GGCC 1 cut(s) 253
Hin1II CATG 2 cut(s) 41, 64
HincII GTYRAC 1 cut(s) 34
HindII GTYRAC 1 cut(s) 34
HindIII AAGCTT 1 cut(s) 280
HinfI GANTC 1 cut(s) 239
HpaI GTTAAC 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 244
Hpy8I GTNNAC 1 cut(s) 34
HpyAV CCTTC 2 cut(s) 10, 229
HpyCH4III ACNGT 2 cut(s) 11, 213
HpyCH4V TGCA 2 cut(s) 192, 257
HpyF10VI GCNNNNNNNGC 2 cut(s) 185, 254
HpyF3I CTNAG 1 cut(s) 162
Hsp92II CATG 2 cut(s) 41, 64
Ksp22I TGATCA 1 cut(s) 120
KspAI GTTAAC 1 cut(s) 34
Kzo9I GATC 2 cut(s) 120, 150
LmnI GCTCC 1 cut(s) 158
LpnPI CCDG 3 cut(s) 12, 213, 267
Lsp1109I GCAGC 2 cut(s) 40, 155
LweI GCATC 1 cut(s) 235
MaeI CTAG 1 cut(s) 183
MaeIII GTNAC 1 cut(s) 19
MalI GATC 2 cut(s) 122, 152
MboI GATC 2 cut(s) 120, 150
MluCI AATT 1 cut(s) 203
MlyI GAGTC 1 cut(s) 248
MmeI TCCRAC 2 cut(s) 111, 195
MnlI CCTC 4 cut(s) 59, 133, 159, 253
MseI TTAA 3 cut(s) 33, 129, 298
MwoI GCNNNNNNNGC 2 cut(s) 185, 254
NdeII GATC 2 cut(s) 120, 150
NlaIII CATG 2 cut(s) 41, 64
PaeR7I CTCGAG 1 cut(s) 137
PkrI GCNGC 2 cut(s) 55, 145
PleI GAGTC 1 cut(s) 247
PpsI GAGTC 1 cut(s) 247
PspXI VCTCGAGB 1 cut(s) 137
PstI CTGCAG 1 cut(s) 259
SaqAI TTAA 3 cut(s) 33, 129, 298
SatI GCNGC 2 cut(s) 54, 144
Sau3AI GATC 2 cut(s) 120, 150
SchI GAGTC 1 cut(s) 248
SetI ASST 9 cut(s) 21, 51, 70, 128, 163, 170, 233, 264, 284
SfaNI GCATC 1 cut(s) 235
SfcI CTRYAG 1 cut(s) 255
Sfr274I CTCGAG 1 cut(s) 137
SlaI CTCGAG 1 cut(s) 137
SmlI CTYRAG 1 cut(s) 137
SmoI CTYRAG 1 cut(s) 137
Sse9I AATT 1 cut(s) 203
SspMI CTAG 1 cut(s) 183
TaaI ACNGT 2 cut(s) 11, 213
TaqI TCGA 1 cut(s) 138
TasI AATT 1 cut(s) 203
Tru1I TTAA 3 cut(s) 33, 129, 298
Tru9I TTAA 3 cut(s) 33, 129, 298
TseI GCWGC 2 cut(s) 53, 143
TspDTI ATGAA 1 cut(s) 67
XapI RAATTY 1 cut(s) 203
XhoI CTCGAG 1 cut(s) 137
XspI CTAG 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.