Rmu_co8299661.1_g000001

38.1 kDa protein-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8299661.1
Physical Location & Seq
Reverse (-)
1 .. 826
826 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8299661.1_g000001.1.cds

Sequence Viewer

Length: 432 bp
atgggaaacgcctttaggcttctttacggtcattgctgcaagcccaccaccacagactccgattctcttggcccccacggcgtttccgccgccactgtcggcgtttcggctctcgcccacgatctcttccactttgaaaacaccgcccaggtcccagaaggactgaatcagcatgtagtttcatccaagaaagctcaagctaactggtatagaaaactagttgagagctggcgagaagcgaggccgccaccaataacagctgaagaagcagctaggcttgttattcaaaccctcaagaatcaccaaaaggctgatgttgagggattattggctttctatggtctccctcttcctcatacactggtccaactttcggctggggtcccaacttcattgcctcaaggagtaaagtttgaattccagacactaccg

Protein Analysis

144

Amino Acids

15.67

Weight (kDa)

7.06

Isoelectric Point (pI)

23.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 87, 90, 144, 245
AcsI RAATTY 1 cut(s) 416
AcuI CTGAAG 1 cut(s) 282
AfiI CCNNNNNNNGG 1 cut(s) 373
AgsI TTSAA 3 cut(s) 137, 287, 416
AhlI ACTAGT 1 cut(s) 217
AjnI CCWGG 1 cut(s) 147
AluBI AGCT 5 cut(s) 194, 200, 228, 260, 272
AluI AGCT 5 cut(s) 194, 200, 228, 260, 272
Alw26I GTCTC 1 cut(s) 347
AoxI GGCC 2 cut(s) 70, 242
ApeKI GCWGC 2 cut(s) 36, 269
ApoI RAATTY 1 cut(s) 416
AspS9I GGNCC 4 cut(s) 71, 151, 364, 382
AsuHPI GGTGA 1 cut(s) 293
AvaII GGWCC 3 cut(s) 151, 364, 382
BbvI GCAGC 2 cut(s) 23, 281
BceAI ACGGC 1 cut(s) 94
BciT130I CCWGG 1 cut(s) 149
BcoDI GTCTC 1 cut(s) 347
BcuI ACTAGT 1 cut(s) 217
BfaI CTAG 2 cut(s) 218, 273
BglI GCCNNNNNGGC 1 cut(s) 78
BisI GCNGC 4 cut(s) 37, 90, 245, 270
BlsI GCNGC 4 cut(s) 38, 91, 246, 271
Bme1390I CCNGG 1 cut(s) 149
Bme18I GGWCC 3 cut(s) 151, 364, 382
BmgT120I GGNCC 4 cut(s) 71, 151, 364, 382
BmiI GGNNCC 4 cut(s) 73, 153, 383, 384
BmrFI CCNGG 1 cut(s) 149
BpuEI CTTGAG 3 cut(s) 180, 278, 384
BsaI GGTCTC 1 cut(s) 347
BsaJI CCNNGG 2 cut(s) 76, 147
Bsc4I CCNNNNNNNGG 1 cut(s) 373
Bse1I ACTGG 2 cut(s) 209, 366
Bse3DI GCAATG 2 cut(s) 31, 392
BseBI CCWGG 1 cut(s) 149
BseDI CCNNGG 2 cut(s) 76, 147
BseGI GGATG 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 373
BseMI GCAATG 2 cut(s) 31, 392
BseNI ACTGG 2 cut(s) 209, 366
BseXI GCAGC 2 cut(s) 23, 281
BseYI CCCAGC 1 cut(s) 377
BshFI GGCC 2 cut(s) 72, 244
BslFI GGGAC 2 cut(s) 137, 368
BslI CCNNNNNNNGG 1 cut(s) 373
BsmAI GTCTC 1 cut(s) 347
BsmFI GGGAC 2 cut(s) 137, 368
BsnI GGCC 2 cut(s) 72, 244
Bso31I GGTCTC 1 cut(s) 347
Bsp143I GATC 1 cut(s) 121
BspACI CCGC 4 cut(s) 87, 90, 144, 245
BspANI GGCC 2 cut(s) 72, 244
BspLI GGNNCC 4 cut(s) 73, 153, 383, 384
BspTNI GGTCTC 1 cut(s) 347
BsrDI GCAATG 2 cut(s) 31, 392
BsrI ACTGG 2 cut(s) 209, 366
BssECI CCNNGG 2 cut(s) 76, 147
BssMI GATC 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 149
Bst4CI ACNGT 2 cut(s) 29, 97
Bst6I CTCTTC 2 cut(s) 131, 354
BstC8I GCNNGC 2 cut(s) 41, 230
BstDSI CCRYGG 1 cut(s) 76
BstF5I GGATG 1 cut(s) 182
BstKTI GATC 1 cut(s) 124
BstMAI GTCTC 1 cut(s) 347
BstMBI GATC 1 cut(s) 121
BstMWI GCNNNNNNNGC 2 cut(s) 78, 266
BstNI CCWGG 1 cut(s) 149
BstNSI RCATGY 1 cut(s) 176
BstSCI CCNGG 1 cut(s) 147
BstV1I GCAGC 2 cut(s) 23, 281
BsuRI GGCC 2 cut(s) 72, 244
BtgI CCRYGG 1 cut(s) 76
BtsCI GGATG 1 cut(s) 182
BtsIMutI CAGTG 2 cut(s) 93, 359
Cac8I GCNNGC 2 cut(s) 41, 230
Cfr13I GGNCC 4 cut(s) 71, 151, 364, 382
CviAII CATG 1 cut(s) 173
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eam1104I CTCTTC 2 cut(s) 131, 354
EarI CTCTTC 2 cut(s) 131, 354
EciI GGCGGA 1 cut(s) 76
Eco31I GGTCTC 1 cut(s) 347
Eco47I GGWCC 3 cut(s) 151, 364, 382
Eco57I CTGAAG 1 cut(s) 282
EcoO109I RGGNCCY 2 cut(s) 151, 382
EcoRI GAATTC 1 cut(s) 416
EcoRII CCWGG 1 cut(s) 147
FaeI CATG 1 cut(s) 176
FaiI YATR 4 cut(s) 174, 210, 339, 357
FaqI GGGAC 2 cut(s) 137, 368
FatI CATG 1 cut(s) 172
Fnu4HI GCNGC 4 cut(s) 37, 90, 245, 270
FokI GGATG 1 cut(s) 169
Fsp4HI GCNGC 4 cut(s) 37, 90, 245, 270
FspBI CTAG 2 cut(s) 218, 273
GluI GCNGC 4 cut(s) 37, 90, 245, 270
GsaI CCCAGC 1 cut(s) 381
HaeIII GGCC 2 cut(s) 72, 244
Hin1II CATG 1 cut(s) 176
HinfI GANTC 4 cut(s) 56, 62, 166, 298
HphI GGTGA 1 cut(s) 293
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 295, 421
HpyAV CCTTC 1 cut(s) 152
HpyCH4III ACNGT 2 cut(s) 29, 97
HpyCH4V TGCA 1 cut(s) 39
HpyF10VI GCNNNNNNNGC 2 cut(s) 78, 266
Hsp92II CATG 1 cut(s) 176
KflI GGGWCCC 1 cut(s) 382
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 7 cut(s) 134, 161, 168, 190, 214, 347, 363
Lsp1109I GCAGC 2 cut(s) 23, 281
MaeI CTAG 2 cut(s) 218, 273
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 3 cut(s) 118, 275, 341
MluCI AATT 1 cut(s) 416
MlyI GAGTC 1 cut(s) 50
MmeI TCCRAC 1 cut(s) 391
MnlI CCTC 6 cut(s) 234, 302, 313, 357, 363, 408
MspA1I CMGCKG 1 cut(s) 260
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
MwoI GCNNNNNNNGC 2 cut(s) 78, 266
NdeII GATC 1 cut(s) 121
NlaIII CATG 1 cut(s) 176
NlaIV GGNNCC 4 cut(s) 73, 153, 383, 384
NspI RCATGY 1 cut(s) 176
PfeI GAWTC 3 cut(s) 62, 166, 298
PkrI GCNGC 4 cut(s) 38, 91, 246, 271
PleI GAGTC 1 cut(s) 50
PpsI GAGTC 1 cut(s) 50
PpuMI RGGWCCY 2 cut(s) 151, 382
Psp5II RGGWCCY 2 cut(s) 151, 382
Psp6I CCWGG 1 cut(s) 147
PspFI CCCAGC 1 cut(s) 377
PspGI CCWGG 1 cut(s) 147
PspN4I GGNNCC 4 cut(s) 73, 153, 383, 384
PspPI GGNCC 4 cut(s) 71, 151, 364, 382
PspPPI RGGWCCY 2 cut(s) 151, 382
PvuII CAGCTG 1 cut(s) 260
SatI GCNGC 4 cut(s) 37, 90, 245, 270
Sau3AI GATC 1 cut(s) 121
Sau96I GGNCC 4 cut(s) 71, 151, 364, 382
SchI GAGTC 1 cut(s) 50
ScrFI CCNGG 1 cut(s) 149
SetI ASST 6 cut(s) 153, 196, 202, 230, 262, 274
SinI GGWCC 3 cut(s) 151, 364, 382
SmlI CTYRAG 3 cut(s) 195, 293, 399
SmoI CTYRAG 3 cut(s) 195, 293, 399
SpeI ACTAGT 1 cut(s) 217
Sse9I AATT 1 cut(s) 416
SsiI CCGC 4 cut(s) 87, 90, 144, 245
SspMI CTAG 2 cut(s) 218, 273
StyD4I CCNGG 1 cut(s) 147
TaaI ACNGT 2 cut(s) 29, 97
TasI AATT 1 cut(s) 416
TauI GCSGC 2 cut(s) 92, 247
TfiI GAWTC 3 cut(s) 62, 166, 298
TscAI CASTG 2 cut(s) 100, 366
TseI GCWGC 2 cut(s) 36, 269
TspDTI ATGAA 2 cut(s) 171, 381
TspRI CASTG 2 cut(s) 100, 366
VpaK11BI GGWCC 3 cut(s) 151, 364, 382
XapI RAATTY 1 cut(s) 416
XceI RCATGY 1 cut(s) 176
XcmI CCANNNNNNNNNTGG 1 cut(s) 374
XspI CTAG 2 cut(s) 218, 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.