Rmu_co8305357.1_g000001

domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8305357.1
OG0006510
Physical Location & Seq
Reverse (-)
1 .. 649
649 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8305357.1_g000001.1.cds

Sequence Viewer

Length: 300 bp
atgcagtgggtggttactaatcttcgacctagtggtcctcttggttcaacaccatccaccttctcttggacattcgatctcaatggaatttctgaaatgtatcaatcttatgaagaaacaaatttatggaaaattgtagaagatgtgccccgaggtgtccatgtgaacttcttgaaagcagaaaggagcttgcacagatgggctctagaagatctccagaggattcatgctgctgaggagcttgctgttgaggagggaggtggagttgaaatgcatgtccttgaggatgcaggtcactgg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_6

Protein Analysis

100

Amino Acids

11.43

Weight (kDa)

4.81

Isoelectric Point (pI)

55.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 33
Acc36I ACCTGC 1 cut(s) 281
AcsI RAATTY 2 cut(s) 87, 121
AfiI CCNNNNNNNGG 1 cut(s) 66
AgsI TTSAA 3 cut(s) 48, 175, 269
AluBI AGCT 2 cut(s) 189, 241
AluI AGCT 2 cut(s) 189, 241
Ama87I CYCGRG 1 cut(s) 150
ApeKI GCWGC 1 cut(s) 230
ApoI RAATTY 2 cut(s) 87, 121
AspS9I GGNCC 1 cut(s) 35
AvaI CYCGRG 1 cut(s) 150
AvaII GGWCC 1 cut(s) 35
BaeGI GKGCMC 1 cut(s) 150
BanII GRGCYC 1 cut(s) 205
BbvCI CCTCAGC 1 cut(s) 234
BbvI GCAGC 1 cut(s) 217
BccI CCATC 2 cut(s) 61, 192
BfaI CTAG 2 cut(s) 30, 206
BfuAI ACCTGC 1 cut(s) 281
BglII AGATCT 1 cut(s) 211
BisI GCNGC 1 cut(s) 231
BlsI GCNGC 1 cut(s) 232
Bme18I GGWCC 1 cut(s) 35
BmeT110I CYCGRG 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 35
BmsI GCATC 1 cut(s) 277
BpmI CTGGAG 1 cut(s) 200
Bpu10I CCTNAGC 1 cut(s) 234
BsaJI CCNNGG 1 cut(s) 151
BsaXI ACNNNNNCTCC 2 cut(s) 249, 279
Bsc4I CCNNNNNNNGG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 151
BseGI GGATG 2 cut(s) 53, 292
BseLI CCNNNNNNNGG 1 cut(s) 66
BseMII CTCAG 1 cut(s) 225
BseRI GAGGAG 2 cut(s) 251, 266
BseSI GKGCMC 1 cut(s) 150
BseXI GCAGC 1 cut(s) 217
BsiHKCI CYCGRG 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 66
BsoBI CYCGRG 1 cut(s) 150
Bsp1286I GDGCHC 2 cut(s) 150, 205
Bsp143I GATC 2 cut(s) 76, 211
BspCNI CTCAG 1 cut(s) 226
BspMI ACCTGC 1 cut(s) 281
BssECI CCNNGG 1 cut(s) 151
BssMI GATC 2 cut(s) 76, 211
BstC8I GCNNGC 2 cut(s) 191, 243
BstDEI CTNAG 1 cut(s) 234
BstF5I GGATG 2 cut(s) 53, 292
BstKTI GATC 2 cut(s) 79, 214
BstMBI GATC 2 cut(s) 76, 211
BstNSI RCATGY 1 cut(s) 278
BstSLI GKGCMC 1 cut(s) 150
BstV1I GCAGC 1 cut(s) 217
BstX2I RGATCY 1 cut(s) 211
BstYI RGATCY 1 cut(s) 211
BtsCI GGATG 2 cut(s) 53, 292
BtsI GCAGTG 1 cut(s) 11
BtsIMutI CAGTG 2 cut(s) 11, 295
BveI ACCTGC 1 cut(s) 281
Cac8I GCNNGC 2 cut(s) 191, 243
Cfr13I GGNCC 1 cut(s) 35
CviAII CATG 3 cut(s) 161, 227, 275
CviJI RGCY 3 cut(s) 189, 203, 241
CviKI_1 RGCY 3 cut(s) 189, 203, 241
DdeI CTNAG 1 cut(s) 234
DpnI GATC 2 cut(s) 78, 213
DpnII GATC 2 cut(s) 76, 211
DrdI GACNNNNNNGTC 1 cut(s) 33
DseDI GACNNNNNNGTC 1 cut(s) 33
Eco24I GRGCYC 1 cut(s) 205
Eco47I GGWCC 1 cut(s) 35
Eco88I CYCGRG 1 cut(s) 150
EcoT22I ATGCAT 1 cut(s) 276
EcoT38I GRGCYC 1 cut(s) 205
FaeI CATG 3 cut(s) 164, 230, 278
FaiI YATR 5 cut(s) 111, 127, 162, 228, 276
FatI CATG 3 cut(s) 160, 226, 274
Fnu4HI GCNGC 1 cut(s) 231
FokI GGATG 1 cut(s) 40
FriOI GRGCYC 1 cut(s) 205
Fsp4HI GCNGC 1 cut(s) 231
FspBI CTAG 2 cut(s) 30, 206
GluI GCNGC 1 cut(s) 231
GsuI CTGGAG 1 cut(s) 200
Hin1II CATG 3 cut(s) 164, 230, 278
HinfI GANTC 1 cut(s) 223
Hpy166II GTNNAC 1 cut(s) 166
Hpy188I TCNGA 1 cut(s) 94
Hpy188III TCNNGA 3 cut(s) 172, 206, 217
Hpy8I GTNNAC 1 cut(s) 166
HpyAV CCTTC 1 cut(s) 70
HpyCH4V TGCA 4 cut(s) 4, 193, 274, 290
HpyF3I CTNAG 1 cut(s) 234
Hsp92II CATG 3 cut(s) 164, 230, 278
Kzo9I GATC 2 cut(s) 76, 211
LmnI GCTCC 2 cut(s) 186, 238
LpnPI CCDG 3 cut(s) 230, 276, 283
Lsp1109I GCAGC 1 cut(s) 217
LweI GCATC 1 cut(s) 277
MaeI CTAG 2 cut(s) 30, 206
MaeIII GTNAC 2 cut(s) 13, 293
MalI GATC 2 cut(s) 78, 213
MboI GATC 2 cut(s) 76, 211
MboII GAAGA 4 cut(s) 14, 125, 152, 221
MflI RGATCY 1 cut(s) 211
MhlI GDGCHC 2 cut(s) 150, 205
MluCI AATT 3 cut(s) 87, 121, 132
MnlI CCTC 8 cut(s) 48, 146, 213, 229, 244, 247, 251, 277
Mph1103I ATGCAT 1 cut(s) 276
NdeII GATC 2 cut(s) 76, 211
NlaIII CATG 3 cut(s) 164, 230, 278
NmuCI GTSAC 1 cut(s) 293
NsiI ATGCAT 1 cut(s) 276
NspI RCATGY 1 cut(s) 278
PfeI GAWTC 1 cut(s) 223
PkrI GCNGC 1 cut(s) 232
PspPI GGNCC 1 cut(s) 35
PsuI RGATCY 1 cut(s) 211
SatI GCNGC 1 cut(s) 231
Sau3AI GATC 2 cut(s) 76, 211
Sau96I GGNCC 1 cut(s) 35
SduI GDGCHC 2 cut(s) 150, 205
SetI ASST 7 cut(s) 31, 62, 157, 191, 243, 262, 295
SfaNI GCATC 1 cut(s) 277
SinI GGWCC 1 cut(s) 35
SmlI CTYRAG 1 cut(s) 281
SmoI CTYRAG 1 cut(s) 281
Sse9I AATT 3 cut(s) 87, 121, 132
SspMI CTAG 2 cut(s) 30, 206
TaqI TCGA 2 cut(s) 25, 75
TasI AATT 3 cut(s) 87, 121, 132
TfiI GAWTC 1 cut(s) 223
TseFI GTSAC 1 cut(s) 293
TseI GCWGC 1 cut(s) 230
Tsp45I GTSAC 1 cut(s) 293
TspDTI ATGAA 2 cut(s) 126, 215
VpaK11BI GGWCC 1 cut(s) 35
XapI RAATTY 2 cut(s) 87, 121
XbaI TCTAGA 1 cut(s) 205
XceI RCATGY 1 cut(s) 278
XspI CTAG 2 cut(s) 30, 206
Zsp2I ATGCAT 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.