Rmu_co8329327.1_g000001

F-box-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8329327.1
Physical Location & Seq
Reverse (-)
552 .. 927
376 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8329327.1_g000001.1.cds

Sequence Viewer

Length: 273 bp
atggctcacgagcttgcttcccagatatggttggctgttcttgacaatttagaggaaaccgaacacacttttcaaatacttaaacgtctcgcacaagagggggatgtttttcttccatacccgtactcaagatcaatcaaagtccaatggaaggtgtttgaaaagcttttcactgattttcgtgactgcctcaaccatgtggattactatgatgtcttggctagtgcaaagaacaagtttcagccaataccatctacttggttaggtcactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.64

Weight (kDa)

5.71

Isoelectric Point (pI)

42.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 125
AfiI CCNNNNNNNGG 2 cut(s) 27, 151
AgsI TTSAA 2 cut(s) 74, 161
AluBI AGCT 2 cut(s) 13, 166
AluI AGCT 2 cut(s) 13, 166
Alw26I GTCTC 1 cut(s) 92
BauI CACGAG 1 cut(s) 8
BccI CCATC 1 cut(s) 259
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 1 cut(s) 222
BpuEI CTTGAG 1 cut(s) 112
Bsc4I CCNNNNNNNGG 2 cut(s) 27, 151
BseGI GGATG 1 cut(s) 109
BseLI CCNNNNNNNGG 2 cut(s) 27, 151
BslI CCNNNNNNNGG 2 cut(s) 27, 151
BsmAI GTCTC 1 cut(s) 92
BsmBI CGTCTC 1 cut(s) 92
Bsp143I GATC 1 cut(s) 131
BssMI GATC 1 cut(s) 131
BssSI CACGAG 1 cut(s) 8
Bst2BI CACGAG 1 cut(s) 8
BstC8I GCNNGC 1 cut(s) 15
BstF5I GGATG 1 cut(s) 109
BstKTI GATC 1 cut(s) 134
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 1 cut(s) 131
BstXI CCANNNNNNTGG 1 cut(s) 258
BtsCI GGATG 1 cut(s) 109
BtsIMutI CAGTG 1 cut(s) 171
Cac8I GCNNGC 1 cut(s) 15
Csp6I GTAC 1 cut(s) 124
CviAII CATG 1 cut(s) 197
CviJI RGCY 6 cut(s) 5, 13, 35, 166, 221, 244
CviKI_1 RGCY 6 cut(s) 5, 13, 35, 166, 221, 244
CviQI GTAC 1 cut(s) 124
DpnI GATC 1 cut(s) 133
DpnII GATC 1 cut(s) 131
Esp3I CGTCTC 1 cut(s) 92
FaeI CATG 1 cut(s) 200
FaiI YATR 4 cut(s) 28, 118, 198, 210
FatI CATG 1 cut(s) 196
FokI GGATG 1 cut(s) 116
FspBI CTAG 1 cut(s) 222
Hin1II CATG 1 cut(s) 200
HindIII AAGCTT 1 cut(s) 164
Hpy188III TCNNGA 4 cut(s) 8, 41, 129, 182
HpyAV CCTTC 1 cut(s) 145
HpyCH4IV ACGT 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 227
HpySE526I ACGT 1 cut(s) 85
Hsp92II CATG 1 cut(s) 200
Kzo9I GATC 1 cut(s) 131
LpnPI CCDG 1 cut(s) 35
MaeI CTAG 1 cut(s) 222
MaeII ACGT 1 cut(s) 85
MaeIII GTNAC 2 cut(s) 182, 266
MalI GATC 1 cut(s) 133
MboI GATC 1 cut(s) 131
MboII GAAGA 1 cut(s) 104
MluCI AATT 1 cut(s) 46
MnlI CCTC 3 cut(s) 46, 91, 200
MseI TTAA 1 cut(s) 81
NdeII GATC 1 cut(s) 131
NlaIII CATG 1 cut(s) 200
NmuCI GTSAC 2 cut(s) 182, 266
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 1 cut(s) 131
SetI ASST 5 cut(s) 15, 88, 156, 168, 268
SmlI CTYRAG 1 cut(s) 127
SmoI CTYRAG 1 cut(s) 127
Sse9I AATT 1 cut(s) 46
SspMI CTAG 1 cut(s) 222
TaiI ACGT 1 cut(s) 88
TasI AATT 1 cut(s) 46
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 1 cut(s) 178
TseFI GTSAC 2 cut(s) 182, 266
Tsp45I GTSAC 2 cut(s) 182, 266
TspRI CASTG 1 cut(s) 178
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.