Rmu_co8363365.1_g000001

aminoacylase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8363365.1
Physical Location & Seq
Reverse (-)
277 .. 693
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8363365.1_g000001.1.cds

Sequence Viewer

Length: 270 bp
ctgctagaagaagcggtcaaaaaagctaatggaaaacttggtaaacctgagatttttcctgcttcaacagatgctcgctatttccggctacaaggcttgccagcaattggattctctcctatggctaacactcctattctgctccatgaccataacgagtttctaaacaaagatgaatacttgaaaggaatcaagatttatgaatccattatcaaatcttattcatcttatgctgagcatgcgacggcgggcttgagagatgagttgtag

Protein Analysis

89

Amino Acids

9.97

Weight (kDa)

6.32

Isoelectric Point (pI)

37.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 107
AciI CCGC 2 cut(s) 14, 248
AfiI CCNNNNNNNGG 1 cut(s) 107
AgsI TTSAA 2 cut(s) 66, 184
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
BceAI ACGGC 1 cut(s) 261
BfaI CTAG 1 cut(s) 5
BlpI GCTNAGC 1 cut(s) 234
BmsI GCATC 1 cut(s) 61
Bpu1102I GCTNAGC 1 cut(s) 234
Bsc4I CCNNNNNNNGG 1 cut(s) 107
BseLI CCNNNNNNNGG 1 cut(s) 107
BseMII CTCAG 2 cut(s) 39, 225
BsiSI CCGG 1 cut(s) 85
BslI CCNNNNNNNGG 1 cut(s) 107
Bsp1720I GCTNAGC 1 cut(s) 234
BspACI CCGC 2 cut(s) 14, 248
BspCNI CTCAG 2 cut(s) 40, 226
BstC8I GCNNGC 5 cut(s) 76, 98, 102, 240, 250
BstDEI CTNAG 2 cut(s) 48, 234
BstMWI GCNNNNNNNGC 1 cut(s) 239
BstNSI RCATGY 1 cut(s) 242
Cac8I GCNNGC 5 cut(s) 76, 98, 102, 240, 250
CviAII CATG 2 cut(s) 146, 239
CviJI RGCY 5 cut(s) 26, 88, 96, 125, 252
CviKI_1 RGCY 5 cut(s) 26, 88, 96, 125, 252
DdeI CTNAG 2 cut(s) 48, 234
FaeI CATG 2 cut(s) 149, 242
FaiI YATR 6 cut(s) 122, 147, 153, 201, 231, 240
FatI CATG 2 cut(s) 145, 238
FauI CCCGC 1 cut(s) 241
FspBI CTAG 1 cut(s) 5
HapII CCGG 1 cut(s) 85
Hin1II CATG 2 cut(s) 149, 242
HinfI GANTC 3 cut(s) 111, 189, 203
HpaII CCGG 1 cut(s) 85
Hpy166II GTNNAC 1 cut(s) 44
Hpy188III TCNNGA 1 cut(s) 193
Hpy8I GTNNAC 1 cut(s) 44
Hpy99I CGWCG 1 cut(s) 247
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
HpyF3I CTNAG 2 cut(s) 48, 234
Hsp92II CATG 2 cut(s) 149, 242
LmnI GCTCC 1 cut(s) 147
LpnPI CCDG 4 cut(s) 60, 72, 98, 114
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 5
MboII GAAGA 1 cut(s) 20
MfeI CAATTG 1 cut(s) 105
MluCI AATT 1 cut(s) 105
MspI CCGG 1 cut(s) 85
MunI CAATTG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 239
NlaIII CATG 2 cut(s) 149, 242
NspI RCATGY 1 cut(s) 242
PaeI GCATGC 1 cut(s) 242
PfeI GAWTC 3 cut(s) 111, 189, 203
PflMI CCANNNNNTGG 1 cut(s) 107
SetI ASST 2 cut(s) 28, 49
SfaNI GCATC 1 cut(s) 61
SmlI CTYRAG 1 cut(s) 253
SmoI CTYRAG 1 cut(s) 253
SphI GCATGC 1 cut(s) 242
Sse9I AATT 1 cut(s) 105
SsiI CCGC 2 cut(s) 14, 248
SspMI CTAG 1 cut(s) 5
TasI AATT 1 cut(s) 105
TfiI GAWTC 3 cut(s) 111, 189, 203
TspDTI ATGAA 3 cut(s) 189, 213, 216
Van91I CCANNNNNTGG 1 cut(s) 107
XceI RCATGY 1 cut(s) 242
XspI CTAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.