Rmu_sc0026953.1_g000001

Peptidase family M20/M25/M40

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026953.1
Physical Location & Seq
Forward (+)
1 .. 1448
1448 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026953.1_g000001.1.cds

Sequence Viewer

Length: 330 bp
ctaattgagaagggacccactagagattacacgggtcgccctttaatgacccaaaccgatgattccaatccatggtggtctattttcaagcaagctgtcgcagcagctggagggaaacttgcaaagcctgaaatcttggcttcaaccactgatgcacggttcatgagacagcaaggcattcctactctcggtttctccccaatgacaaatactccaatcttactgcacgaccataatgagttcttaaaagataccatattcttgaaaggcatcaaagtatatgaatctataatcagtgctttgagttccttcgagggaggatcacgttag

Protein Analysis

109

Amino Acids

12.04

Weight (kDa)

8.26

Isoelectric Point (pI)

24.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 72
AclWI GGATC 1 cut(s) 328
AfiI CCNNNNNNNGG 2 cut(s) 72, 188
AgsI TTSAA 3 cut(s) 88, 144, 265
AluBI AGCT 2 cut(s) 95, 107
AluI AGCT 2 cut(s) 95, 107
Alw26I GTCTC 1 cut(s) 160
AlwI GGATC 1 cut(s) 328
AlwNI CAGNNNCTG 1 cut(s) 107
ApeKI GCWGC 2 cut(s) 101, 104
AspS9I GGNCC 1 cut(s) 14
AvaII GGWCC 1 cut(s) 14
BbvI GCAGC 2 cut(s) 113, 116
BcoDI GTCTC 1 cut(s) 160
BfaI CTAG 1 cut(s) 21
BisI GCNGC 2 cut(s) 102, 105
BlsI GCNGC 2 cut(s) 103, 106
Bme18I GGWCC 1 cut(s) 14
BmgT120I GGNCC 1 cut(s) 14
BmiI GGNNCC 2 cut(s) 15, 16
BmsI GCATC 2 cut(s) 142, 279
BpmI CTGGAG 1 cut(s) 129
BsaBI GATNNNNATC 1 cut(s) 66
BsaJI CCNNGG 1 cut(s) 71
BsaXI ACNNNNNCTCC 2 cut(s) 196, 226
Bsc4I CCNNNNNNNGG 2 cut(s) 72, 188
Bse8I GATNNNNATC 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 71
BseJI GATNNNNATC 1 cut(s) 66
BseLI CCNNNNNNNGG 2 cut(s) 72, 188
BseXI GCAGC 2 cut(s) 113, 116
BsgI GTGCAG 1 cut(s) 209
BslFI GGGAC 1 cut(s) 27
BslI CCNNNNNNNGG 2 cut(s) 72, 188
BsmAI GTCTC 1 cut(s) 160
BsmFI GGGAC 1 cut(s) 27
BsmI GAATGC 1 cut(s) 177
Bsp143I GATC 1 cut(s) 320
Bsp19I CCATGG 1 cut(s) 71
BspHI TCATGA 1 cut(s) 162
BspLI GGNNCC 2 cut(s) 15, 16
BspPI GGATC 1 cut(s) 328
BssECI CCNNGG 1 cut(s) 71
BssMI GATC 1 cut(s) 320
BssT1I CCWWGG 1 cut(s) 71
Bst4CI ACNGT 1 cut(s) 159
BstC8I GCNNGC 1 cut(s) 93
BstDSI CCRYGG 1 cut(s) 71
BstKTI GATC 1 cut(s) 323
BstMAI GTCTC 1 cut(s) 160
BstMBI GATC 1 cut(s) 320
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstV1I GCAGC 2 cut(s) 113, 116
BtgI CCRYGG 1 cut(s) 71
BtsIMutI CAGTG 2 cut(s) 147, 301
Cac8I GCNNGC 1 cut(s) 93
CaiI CAGNNNCTG 1 cut(s) 107
CciI TCATGA 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 14
CviAII CATG 2 cut(s) 72, 163
CviJI RGCY 4 cut(s) 95, 107, 127, 140
CviKI_1 RGCY 4 cut(s) 95, 107, 127, 140
DpnI GATC 1 cut(s) 322
DpnII GATC 1 cut(s) 320
Eco130I CCWWGG 1 cut(s) 71
Eco47I GGWCC 1 cut(s) 14
EcoO109I RGGNCCY 1 cut(s) 14
EcoT14I CCWWGG 1 cut(s) 71
ErhI CCWWGG 1 cut(s) 71
FaeI CATG 2 cut(s) 75, 166
FaiI YATR 7 cut(s) 73, 164, 234, 257, 280, 282, 290
FaqI GGGAC 1 cut(s) 27
FatI CATG 2 cut(s) 71, 162
Fnu4HI GCNGC 2 cut(s) 102, 105
Fsp4HI GCNGC 2 cut(s) 102, 105
FspBI CTAG 1 cut(s) 21
GluI GCNGC 2 cut(s) 102, 105
GsuI CTGGAG 1 cut(s) 129
Hin1II CATG 2 cut(s) 75, 166
HinfI GANTC 2 cut(s) 62, 284
Hpy188III TCNNGA 2 cut(s) 163, 262
HpyAV CCTTC 2 cut(s) 4, 319
HpyCH4III ACNGT 1 cut(s) 159
HpyCH4IV ACGT 1 cut(s) 325
HpyCH4V TGCA 3 cut(s) 122, 155, 226
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpySE526I ACGT 1 cut(s) 325
Hsp92II CATG 2 cut(s) 75, 166
KflI GGGWCCC 1 cut(s) 14
Kzo9I GATC 1 cut(s) 320
LpnPI CCDG 2 cut(s) 93, 141
Lsp1109I GCAGC 2 cut(s) 113, 116
LweI GCATC 2 cut(s) 142, 279
MaeI CTAG 1 cut(s) 21
MaeII ACGT 1 cut(s) 325
MalI GATC 1 cut(s) 322
MboI GATC 1 cut(s) 320
MluCI AATT 1 cut(s) 3
MnlI CCTC 3 cut(s) 104, 307, 311
MseI TTAA 2 cut(s) 44, 245
MspA1I CMGCKG 1 cut(s) 107
Mva1269I GAATGC 1 cut(s) 177
MwoI GCNNNNNNNGC 1 cut(s) 101
NcoI CCATGG 1 cut(s) 71
NdeII GATC 1 cut(s) 320
NlaIII CATG 2 cut(s) 75, 166
NlaIV GGNNCC 2 cut(s) 15, 16
PagI TCATGA 1 cut(s) 162
PctI GAATGC 1 cut(s) 177
PfeI GAWTC 2 cut(s) 62, 284
PflMI CCANNNNNTGG 1 cut(s) 72
PkrI GCNGC 2 cut(s) 103, 106
PpuMI RGGWCCY 1 cut(s) 14
Psp5II RGGWCCY 1 cut(s) 14
PspN4I GGNNCC 2 cut(s) 15, 16
PspPI GGNCC 1 cut(s) 14
PspPPI RGGWCCY 1 cut(s) 14
PstNI CAGNNNCTG 1 cut(s) 107
PvuII CAGCTG 1 cut(s) 107
SaqAI TTAA 2 cut(s) 44, 245
SatI GCNGC 2 cut(s) 102, 105
Sau3AI GATC 1 cut(s) 320
Sau96I GGNCC 1 cut(s) 14
SetI ASST 3 cut(s) 97, 109, 328
SfaNI GCATC 2 cut(s) 142, 279
SinI GGWCC 1 cut(s) 14
Sse9I AATT 1 cut(s) 3
SspMI CTAG 1 cut(s) 21
StyI CCWWGG 1 cut(s) 71
TaaI ACNGT 1 cut(s) 159
TaiI ACGT 1 cut(s) 328
TaqI TCGA 1 cut(s) 312
TasI AATT 1 cut(s) 3
TfiI GAWTC 2 cut(s) 62, 284
Tru1I TTAA 2 cut(s) 44, 245
Tru9I TTAA 2 cut(s) 44, 245
TscAI CASTG 2 cut(s) 154, 301
TseI GCWGC 2 cut(s) 101, 104
TspDTI ATGAA 2 cut(s) 151, 297
TspRI CASTG 2 cut(s) 154, 301
Van91I CCANNNNNTGG 1 cut(s) 72
VpaK11BI GGWCC 1 cut(s) 14
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.