Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8373963.1

Orthogroup ID

OG0006021

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 519

Gene Structure 519 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8373963.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 312 bp

ataatggattatgcatctcttccccatttctgtaaaagggaaggttctggatcatctcggcattcacagaatggaactgacaattgcttctccttggatcaccattttcatcaacagctctacaactacatcaagcagcaatctttgatcaatgaatctgttcaaccaatcaagcagggttcttttcaagcggacatacctgagcgagctgcagaaggaacacagatgacaatagaatctgagttcaacaaatttggtaacggcgatggggtatctgactctctaaatgccctcaaaatcaatggtgactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CRAL_TRIO CRAL_TRIO_N

Protein Analysis

103

Amino Acids

11.48

Weight (kDa)

5.39

Isoelectric Point (pI)

40.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006021)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G47730 AT5G47730 AT5G47730 AT5G47730
fragaria_vesca	FvH4_3g00280 FvH4_3g00280 FvH4_3g00280 FvH4_4g17420
malus_domestica	MD05G1362300.v1.1 MD10G1339800.v1.1
prunus_persica	Prupe.4G003100_v2.0.a1 Prupe.4G003100_v2.0.a1 Prupe.4G003100_v2.0.a1 Prupe.4G003100_v2.0.a1
pyrus_communis	pycom05g32870 pycom10g28960
rosa_chinensis	RchiOBHm_Chr5g0000411
rosa_laevigata	RLG00000030864
rosa_multiflora	Rmu_co8373963.1_g000001 Rmu_sc0003949.1_g000001
rosa_roxburghii	Rroxscaffold_1G00075750
rosa_rugosa	Rorug04G0383400
rosa_samantha	Rh5AG003300 Rh5BG004400 Rh5CG003500 Rh5DG003400
rosa_wichuraiana	Rw5G000330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	191
AclWI	GGATC	2 cut(s)	58, 105
AcsI	RAATTY	1 cut(s)	251
AgsI	TTSAA	3 cut(s)	164, 188, 247
AluBI	AGCT	2 cut(s)	118, 209
AluI	AGCT	2 cut(s)	118, 209
AlwI	GGATC	2 cut(s)	58, 105
ApeKI	GCWGC	2 cut(s)	136, 209
ApoI	RAATTY	1 cut(s)	251
Asp700I	GAANNNNTTC	1 cut(s)	159
AsuHPI	GGTGA	1 cut(s)	92
BbvI	GCAGC	2 cut(s)	148, 196
BccI	CCATC	1 cut(s)	260
BceAI	ACGGC	1 cut(s)	277
BclI	TGATCA	1 cut(s)	147
BfmI	CTRYAG	1 cut(s)	210
BisI	GCNGC	2 cut(s)	137, 210
BlsI	GCNGC	2 cut(s)	138, 211
BmsI	GCATC	1 cut(s)	23
Bpu10I	CCTNAGC	1 cut(s)	201
BsaJI	CCNNGG	1 cut(s)	93
BseDI	CCNNGG	1 cut(s)	93
BseMII	CTCAG	2 cut(s)	192, 231
BseXI	GCAGC	2 cut(s)	148, 196
BsmI	GAATGC	1 cut(s)	61
Bsp143I	GATC	3 cut(s)	50, 97, 147
BspACI	CCGC	1 cut(s)	191
BspCNI	CTCAG	2 cut(s)	193, 232
BspMAI	CTGCAG	1 cut(s)	214
BspPI	GGATC	2 cut(s)	58, 105
BssECI	CCNNGG	1 cut(s)	93
BssMI	GATC	3 cut(s)	50, 97, 147
BssT1I	CCWWGG	1 cut(s)	93
Bst6I	CTCTTC	1 cut(s)	24
BstC8I	GCNNGC	1 cut(s)	207
BstDEI	CTNAG	2 cut(s)	201, 240
BstKTI	GATC	3 cut(s)	53, 100, 150
BstMBI	GATC	3 cut(s)	50, 97, 147
BstSFI	CTRYAG	1 cut(s)	210
BstV1I	GCAGC	2 cut(s)	148, 196
BtgZI	GCGATG	1 cut(s)	279
Cac8I	GCNNGC	1 cut(s)	207
CviJI	RGCY	2 cut(s)	118, 209
CviKI_1	RGCY	2 cut(s)	118, 209
DdeI	CTNAG	2 cut(s)	201, 240
DpnI	GATC	3 cut(s)	52, 99, 149
DpnII	GATC	3 cut(s)	50, 97, 147
Eam1104I	CTCTTC	1 cut(s)	24
EarI	CTCTTC	1 cut(s)	24
Eco130I	CCWWGG	1 cut(s)	93
EcoT14I	CCWWGG	1 cut(s)	93
EcoT22I	ATGCAT	1 cut(s)	16
ErhI	CCWWGG	1 cut(s)	93
FaiI	YATR	2 cut(s)	12, 197
FbaI	TGATCA	1 cut(s)	147
Fnu4HI	GCNGC	2 cut(s)	137, 210
Fsp4HI	GCNGC	2 cut(s)	137, 210
GluI	GCNGC	2 cut(s)	137, 210
HinfI	GANTC	3 cut(s)	155, 236, 278
HphI	GGTGA	1 cut(s)	92
Hpy188I	TCNGA	2 cut(s)	241, 277
Hpy188III	TCNNGA	1 cut(s)	48
HpyAV	CCTTC	2 cut(s)	35, 209
HpyCH4V	TGCA	2 cut(s)	14, 212
HpyF3I	CTNAG	2 cut(s)	201, 240
Ksp22I	TGATCA	1 cut(s)	147
Kzo9I	GATC	3 cut(s)	50, 97, 147
LpnPI	CCDG	3 cut(s)	33, 161, 213
Lsp1109I	GCAGC	2 cut(s)	148, 196
LweI	GCATC	1 cut(s)	23
MaeIII	GTNAC	2 cut(s)	257, 305
MalI	GATC	3 cut(s)	52, 99, 149
MboI	GATC	3 cut(s)	50, 97, 147
MboII	GAAGA	1 cut(s)	11
MfeI	CAATTG	1 cut(s)	82
MluCI	AATT	2 cut(s)	82, 251
MlyI	GAGTC	1 cut(s)	272
MnlI	CCTC	1 cut(s)	302
Mph1103I	ATGCAT	1 cut(s)	16
MroXI	GAANNNNTTC	1 cut(s)	159
MunI	CAATTG	1 cut(s)	82
Mva1269I	GAATGC	1 cut(s)	61
NdeII	GATC	3 cut(s)	50, 97, 147
NmeAIII	GCCGAG	1 cut(s)	37
NmuCI	GTSAC	1 cut(s)	305
NsiI	ATGCAT	1 cut(s)	16
PctI	GAATGC	1 cut(s)	61
PdmI	GAANNNNTTC	1 cut(s)	159
PfeI	GAWTC	2 cut(s)	155, 236
PkrI	GCNGC	2 cut(s)	138, 211
PleI	GAGTC	1 cut(s)	272
PpsI	GAGTC	1 cut(s)	272
PstI	CTGCAG	1 cut(s)	214
SatI	GCNGC	2 cut(s)	137, 210
Sau3AI	GATC	3 cut(s)	50, 97, 147
SchI	GAGTC	1 cut(s)	272
SetI	ASST	4 cut(s)	46, 120, 202, 211
SfaNI	GCATC	1 cut(s)	23
SfcI	CTRYAG	1 cut(s)	210
SgeI	CNNG	9 cut(s)	60, 69, 106, 145, 184, 188, 200, 212, 218
Sse9I	AATT	2 cut(s)	82, 251
SsiI	CCGC	1 cut(s)	191
StyI	CCWWGG	1 cut(s)	93
TasI	AATT	2 cut(s)	82, 251
TfiI	GAWTC	2 cut(s)	155, 236
TseFI	GTSAC	1 cut(s)	305
TseI	GCWGC	2 cut(s)	136, 209
Tsp45I	GTSAC	1 cut(s)	305
TspDTI	ATGAA	2 cut(s)	98, 168
XapI	RAATTY	1 cut(s)	251
XmnI	GAANNNNTTC	1 cut(s)	159
Zsp2I	ATGCAT	1 cut(s)	16

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.