Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8376675.1

Orthogroup ID

OG0005614

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 903

Gene Structure 903 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8376675.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 223 bp

atgctgaagtggtcaccaactggcgattactttttctccgcaaaatttgatggaacgttttatctttgggagacaaacacatgggcatctgaatcatggtcatcaactagcggctttgtaaagggagcatcatgggatcctgatgggcgtatgatacttcttgccttctctaaatcttcaactttggggtccattcactttgcttcaaagccgccatctctgg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003008 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005635 GO:0005643 GO:0005654 GO:0005737 GO:0005783 GO:0005813 GO:0005815 GO:0005829 GO:0005856 GO:0006810 GO:0006913 GO:0007610 GO:0007611 GO:0007612 GO:0008150 GO:0009566 GO:0012505 GO:0015630 GO:0016020 GO:0019953 GO:0022414 GO:0031090 GO:0031965 GO:0031967 GO:0031974 GO:0031975 GO:0031981 GO:0032501 GO:0032991 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044430 GO:0044444 GO:0044446 GO:0044464 GO:0044703 GO:0046907 GO:0050877 GO:0050890 GO:0051169 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0051704 GO:0070013

KEGG Pathways

Metabolic & Signaling

ko03013 map03013

Pfam Domains

Protein Families

ANAPC4_WD40 WD40

Protein Analysis

74

Amino Acids

8.25

Weight (kDa)

6.52

Isoelectric Point (pI)

29.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005614)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G56900
fragaria_vesca	FvH4_7g04320 FvH4_7g04320 FvH4_7g04320 FvH4_7g04320
malus_domestica	MD12G1112000.v1.1 MD14G1101000.v1.1 MD14G1101100.v1.1
prunus_persica	Prupe.7G021600_v2.0.a1 Prupe.7G021600_v2.0.a1 Prupe.7G021600_v2.0.a1 Prupe.7G021600_v2.0.a1
pyrus_communis	pycom12g09160 pycom14g08800
rosa_chinensis	RchiOBHm_Chr1g0329271 RchiOBHm_Chr1g0329281
rosa_laevigata	RLG00000029905
rosa_multiflora	Rmu_co8376675.1_g000001 Rmu_sc0000203.1_g000006 Rmu_sc0010272.1_g000001
rosa_rugosa	Rorug01G0077700
rosa_samantha	Rh1AG096600 Rh1BG077300 Rh1CG093300 Rh1DG099600 Rh1DG100000
rosa_wichuraiana	Rw1G007480 Rw1G007560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	39, 111, 212
AclI	AACGTT	1 cut(s)	56
AclWI	GGATC	2 cut(s)	131, 144
AcsI	RAATTY	1 cut(s)	44
AcuI	CTGAAG	1 cut(s)	26
AgsI	TTSAA	2 cut(s)	180, 207
Alw26I	GTCTC	1 cut(s)	65
AlwI	GGATC	2 cut(s)	131, 144
ApoI	RAATTY	1 cut(s)	44
AspS9I	GGNCC	1 cut(s)	189
AsuHPI	GGTGA	1 cut(s)	6
AvaII	GGWCC	1 cut(s)	189
BamHI	GGATCC	1 cut(s)	136
BccI	CCATC	2 cut(s)	44, 137
BcoDI	GTCTC	1 cut(s)	65
BfaI	CTAG	1 cut(s)	108
BisI	GCNGC	2 cut(s)	112, 212
BlsI	GCNGC	2 cut(s)	113, 213
Bme18I	GGWCC	1 cut(s)	189
BmgT120I	GGNCC	1 cut(s)	189
BmiI	GGNNCC	2 cut(s)	138, 190
BmsI	GCATC	2 cut(s)	95, 137
BsaXI	ACNNNNNCTCC	2 cut(s)	20, 50
Bse1I	ACTGG	1 cut(s)	25
BseNI	ACTGG	1 cut(s)	25
BsmAI	GTCTC	1 cut(s)	65
Bsp143I	GATC	1 cut(s)	136
BspACI	CCGC	3 cut(s)	39, 111, 212
BspLI	GGNNCC	2 cut(s)	138, 190
BspPI	GGATC	2 cut(s)	131, 144
BsrI	ACTGG	1 cut(s)	25
BssMI	GATC	1 cut(s)	136
BstEII	GGTNACC	1 cut(s)	12
BstKTI	GATC	1 cut(s)	139
BstMAI	GTCTC	1 cut(s)	65
BstMBI	GATC	1 cut(s)	136
BstPI	GGTNACC	1 cut(s)	12
BstX2I	RGATCY	1 cut(s)	136
BstYI	RGATCY	1 cut(s)	136
Cfr13I	GGNCC	1 cut(s)	189
CviAII	CATG	3 cut(s)	81, 96, 132
CviJI	RGCY	2 cut(s)	114, 211
CviKI_1	RGCY	2 cut(s)	114, 211
DpnI	GATC	1 cut(s)	138
DpnII	GATC	1 cut(s)	136
Eco47I	GGWCC	1 cut(s)	189
Eco57I	CTGAAG	1 cut(s)	26
Eco91I	GGTNACC	1 cut(s)	12
EcoO65I	GGTNACC	1 cut(s)	12
FaeI	CATG	3 cut(s)	84, 99, 135
FaiI	YATR	4 cut(s)	82, 97, 133, 152
FatI	CATG	3 cut(s)	80, 95, 131
Fnu4HI	GCNGC	2 cut(s)	112, 212
Fsp4HI	GCNGC	2 cut(s)	112, 212
FspBI	CTAG	1 cut(s)	108
GluI	GCNGC	2 cut(s)	112, 212
Hin1II	CATG	3 cut(s)	84, 99, 135
HinfI	GANTC	1 cut(s)	92
HphI	GGTGA	1 cut(s)	6
Hpy188I	TCNGA	1 cut(s)	91
Hpy188III	TCNNGA	1 cut(s)	140
HpyAV	CCTTC	1 cut(s)	175
HpyCH4IV	ACGT	1 cut(s)	56
HpySE526I	ACGT	1 cut(s)	56
Hsp92II	CATG	3 cut(s)	84, 99, 135
Kzo9I	GATC	1 cut(s)	136
LmnI	GCTCC	1 cut(s)	125
LpnPI	CCDG	3 cut(s)	6, 153, 206
LweI	GCATC	2 cut(s)	95, 137
MaeI	CTAG	1 cut(s)	108
MaeII	ACGT	1 cut(s)	56
MaeIII	GTNAC	1 cut(s)	12
MalI	GATC	1 cut(s)	138
MboI	GATC	1 cut(s)	136
MboII	GAAGA	1 cut(s)	168
MflI	RGATCY	1 cut(s)	136
MluCI	AATT	1 cut(s)	44
NdeII	GATC	1 cut(s)	136
NlaIII	CATG	3 cut(s)	84, 99, 135
NlaIV	GGNNCC	2 cut(s)	138, 190
NmuCI	GTSAC	1 cut(s)	12
PfeI	GAWTC	1 cut(s)	92
PkrI	GCNGC	2 cut(s)	113, 213
Psp1406I	AACGTT	1 cut(s)	56
PspEI	GGTNACC	1 cut(s)	12
PspN4I	GGNNCC	2 cut(s)	138, 190
PspPI	GGNCC	1 cut(s)	189
PsuI	RGATCY	1 cut(s)	136
SatI	GCNGC	2 cut(s)	112, 212
Sau3AI	GATC	1 cut(s)	136
Sau96I	GGNCC	1 cut(s)	189
SetI	ASST	1 cut(s)	59
SfaNI	GCATC	2 cut(s)	95, 137
SgeI	CNNG	7 cut(s)	33, 93, 108, 120, 144, 152, 173
SinI	GGWCC	1 cut(s)	189
Sse9I	AATT	1 cut(s)	44
SsiI	CCGC	3 cut(s)	39, 111, 212
SspMI	CTAG	1 cut(s)	108
TaiI	ACGT	1 cut(s)	59
TasI	AATT	1 cut(s)	44
TauI	GCSGC	2 cut(s)	114, 214
TfiI	GAWTC	1 cut(s)	92
TseFI	GTSAC	1 cut(s)	12
Tsp45I	GTSAC	1 cut(s)	12
VpaK11BI	GGWCC	1 cut(s)	189
XapI	RAATTY	1 cut(s)	44
XspI	CTAG	1 cut(s)	108

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.