Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8387427.1

Orthogroup ID

OG0005805

Physical Location & Seq

Genomic Coordinates Reverse (-)

317 .. 1068

Gene Structure 752 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8387427.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 291 bp

atgtgtgaatgtaggggaataagtgatgaggccctggatttgtcagatttgcattgcagtattccaatgaagggcatggtggattctttcaatgtttcagttgctgcaggcattctcatgcaccatgctgtttgtgatagaacttctcgcctgggctgtcatggtgatctgacatctgaagagaaccaaattcttcttgctgagttttctctgcgtcatagcaagaattcaattagcattgctcatgagtatgcaaagcggaaggcagctctgctcacaccaaggctttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001510 GO:0002128 GO:0002938 GO:0003674 GO:0003824 GO:0006139 GO:0006396 GO:0006399 GO:0006400 GO:0006725 GO:0006807 GO:0008033 GO:0008150 GO:0008152 GO:0008168 GO:0008171 GO:0008173 GO:0008175 GO:0008757 GO:0009020 GO:0009451 GO:0009987 GO:0010467 GO:0016070 GO:0016423 GO:0016740 GO:0016741 GO:0030488 GO:0032259 GO:0034470 GO:0034641 GO:0034660 GO:0043170 GO:0043412 GO:0043414 GO:0044237 GO:0044238 GO:0044260 GO:0046483 GO:0071704 GO:0090304 GO:0106050 GO:0140098 GO:0140101 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SpoU_methylase

Protein Analysis

96

Amino Acids

10.54

Weight (kDa)

6.27

Isoelectric Point (pI)

38.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005805)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G15390 AT5G15390
fragaria_vesca	FvH4_6g47560 FvH4_6g47560 FvH4_6g47560 FvH4_6g47560 FvH4_6g47560
malus_domestica	MD07G1179900.v1.1 MD11G1144500.v1.1 MD17G1055800.v1.1
prunus_persica	Prupe.3G259900_v2.0.a1
pyrus_communis	pycom17g05470
rosa_chinensis	RchiOBHm_Chr2g0166661
rosa_laevigata	RLG00000021639
rosa_multiflora	Rmu_co8387427.1_g000001 Rmu_sc0005279.1_g000001 Rmu_sc0016352.1_g000001 Rmu_sc0032184.1_g000001
rosa_roxburghii	Rroxscaffold_2G00084320 Rroxscaffold_2G00084630
rosa_rugosa	Rorug02G0524700 Rorug02G0524800
rosa_samantha	Rh2AG591100 Rh2BG602900 Rh2CG573800 Rh2DG613700 Rh4DG034600
rosa_wichuraiana	Rw2G049230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	259
AcsI	RAATTY	2 cut(s)	189, 226
AcuI	CTGAAG	1 cut(s)	198
AfiI	CCNNNNNNNGG	1 cut(s)	71
AgsI	TTSAA	2 cut(s)	91, 231
AjnI	CCWGG	2 cut(s)	33, 150
AluBI	AGCT	1 cut(s)	269
AluI	AGCT	1 cut(s)	269
AlwNI	CAGNNNCTG	1 cut(s)	104
AoxI	GGCC	1 cut(s)	30
ApeKI	GCWGC	2 cut(s)	104, 266
ApoI	RAATTY	2 cut(s)	189, 226
AspS9I	GGNCC	1 cut(s)	31
AsuHPI	GGTGA	1 cut(s)	176
BbvI	GCAGC	2 cut(s)	91, 278
BciT130I	CCWGG	2 cut(s)	35, 152
BfmI	CTRYAG	1 cut(s)	105
BisI	GCNGC	2 cut(s)	105, 267
BlsI	GCNGC	2 cut(s)	106, 268
Bme1390I	CCNGG	2 cut(s)	35, 152
BmgT120I	GGNCC	1 cut(s)	31
BmrFI	CCNGG	2 cut(s)	35, 152
BsaJI	CCNNGG	3 cut(s)	33, 151, 281
Bsc4I	CCNNNNNNNGG	1 cut(s)	71
Bse3DI	GCAATG	2 cut(s)	52, 237
BseBI	CCWGG	2 cut(s)	35, 152
BseDI	CCNNGG	3 cut(s)	33, 151, 281
BseLI	CCNNNNNNNGG	1 cut(s)	71
BseMI	GCAATG	2 cut(s)	52, 237
BseMII	CTCAG	1 cut(s)	192
BseXI	GCAGC	2 cut(s)	91, 278
BshFI	GGCC	1 cut(s)	32
BslI	CCNNNNNNNGG	1 cut(s)	71
BsmI	GAATGC	1 cut(s)	111
BsnI	GGCC	1 cut(s)	32
Bsp143I	GATC	1 cut(s)	166
BspACI	CCGC	1 cut(s)	259
BspANI	GGCC	1 cut(s)	32
BspCNI	CTCAG	1 cut(s)	193
BspHI	TCATGA	1 cut(s)	244
BspMAI	CTGCAG	1 cut(s)	109
BsrDI	GCAATG	2 cut(s)	52, 237
BssECI	CCNNGG	3 cut(s)	33, 151, 281
BssMI	GATC	1 cut(s)	166
BssT1I	CCWWGG	1 cut(s)	281
Bst2UI	CCWGG	2 cut(s)	35, 152
Bst6I	CTCTTC	1 cut(s)	174
BstC8I	GCNNGC	1 cut(s)	109
BstDEI	CTNAG	1 cut(s)	201
BstKTI	GATC	1 cut(s)	169
BstMBI	GATC	1 cut(s)	166
BstNI	CCWGG	2 cut(s)	35, 152
BstSCI	CCNGG	2 cut(s)	33, 150
BstSFI	CTRYAG	1 cut(s)	105
BstV1I	GCAGC	2 cut(s)	91, 278
BsuRI	GGCC	1 cut(s)	32
Cac8I	GCNNGC	1 cut(s)	109
CaiI	CAGNNNCTG	1 cut(s)	104
CciI	TCATGA	1 cut(s)	244
Cfr13I	GGNCC	1 cut(s)	31
CseI	GACGC	1 cut(s)	203
CviAII	CATG	5 cut(s)	76, 118, 125, 161, 245
CviJI	RGCY	4 cut(s)	32, 156, 269, 286
CviKI_1	RGCY	4 cut(s)	32, 156, 269, 286
DdeI	CTNAG	1 cut(s)	201
DpnI	GATC	1 cut(s)	168
DpnII	GATC	1 cut(s)	166
Eam1104I	CTCTTC	1 cut(s)	174
EarI	CTCTTC	1 cut(s)	174
Eco130I	CCWWGG	1 cut(s)	281
Eco57I	CTGAAG	1 cut(s)	198
EcoO109I	RGGNCCY	1 cut(s)	31
EcoRI	GAATTC	1 cut(s)	226
EcoRII	CCWGG	2 cut(s)	33, 150
EcoT14I	CCWWGG	1 cut(s)	281
ErhI	CCWWGG	1 cut(s)	281
FaeI	CATG	5 cut(s)	79, 121, 128, 164, 248
FaiI	YATR	7 cut(s)	77, 119, 126, 162, 219, 246, 252
FatI	CATG	5 cut(s)	75, 117, 124, 160, 244
Fnu4HI	GCNGC	2 cut(s)	105, 267
Fsp4HI	GCNGC	2 cut(s)	105, 267
GluI	GCNGC	2 cut(s)	105, 267
HaeIII	GGCC	1 cut(s)	32
HgaI	GACGC	1 cut(s)	203
Hin1II	CATG	5 cut(s)	79, 121, 128, 164, 248
HinfI	GANTC	1 cut(s)	83
HphI	GGTGA	1 cut(s)	176
Hpy188I	TCNGA	3 cut(s)	46, 171, 178
Hpy188III	TCNNGA	1 cut(s)	245
HpyAV	CCTTC	2 cut(s)	64, 256
HpyCH4V	TGCA	5 cut(s)	52, 57, 107, 121, 254
HpyF3I	CTNAG	1 cut(s)	201
Hsp92II	CATG	5 cut(s)	79, 121, 128, 164, 248
Kzo9I	GATC	1 cut(s)	166
LpnPI	CCDG	5 cut(s)	20, 47, 93, 137, 164
Lsp1109I	GCAGC	2 cut(s)	91, 278
MalI	GATC	1 cut(s)	168
MboI	GATC	1 cut(s)	166
MboII	GAAGA	2 cut(s)	185, 191
MluCI	AATT	3 cut(s)	189, 226, 231
MnlI	CCTC	1 cut(s)	22
MslI	CAYNNNNRTG	2 cut(s)	116, 249
MspR9I	CCNGG	2 cut(s)	35, 152
Mva1269I	GAATGC	1 cut(s)	111
MvaI	CCWGG	2 cut(s)	35, 152
NdeII	GATC	1 cut(s)	166
NlaIII	CATG	5 cut(s)	79, 121, 128, 164, 248
PagI	TCATGA	1 cut(s)	244
PctI	GAATGC	1 cut(s)	111
PfeI	GAWTC	1 cut(s)	83
PkrI	GCNGC	2 cut(s)	106, 268
Psp6I	CCWGG	2 cut(s)	33, 150
PspGI	CCWGG	2 cut(s)	33, 150
PspPI	GGNCC	1 cut(s)	31
PstI	CTGCAG	1 cut(s)	109
PstNI	CAGNNNCTG	1 cut(s)	104
RseI	CAYNNNNRTG	2 cut(s)	116, 249
SatI	GCNGC	2 cut(s)	105, 267
Sau3AI	GATC	1 cut(s)	166
Sau96I	GGNCC	1 cut(s)	31
ScrFI	CCNGG	2 cut(s)	35, 152
SetI	ASST	1 cut(s)	271
SfcI	CTRYAG	1 cut(s)	105
SmiMI	CAYNNNNRTG	2 cut(s)	116, 249
Sse9I	AATT	3 cut(s)	189, 226, 231
SsiI	CCGC	1 cut(s)	259
StyD4I	CCNGG	2 cut(s)	33, 150
StyI	CCWWGG	1 cut(s)	281
TasI	AATT	3 cut(s)	189, 226, 231
TfiI	GAWTC	1 cut(s)	83
TseI	GCWGC	2 cut(s)	104, 266
TspDTI	ATGAA	1 cut(s)	83
XapI	RAATTY	2 cut(s)	189, 226

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.