Rmu_co8406507.1_g000001

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8406507.1
Physical Location & Seq
Forward (+)
1 .. 456
456 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8406507.1_g000001.1.cds

Sequence Viewer

Length: 252 bp
cttctatcaaatgacagattcaagagtgtagagcacagggtactggcaaaccgtaaaggtccaagaatatcagttgcaagctttttcagcacaggaatgctgccatcgacaaagctctacagaccaatcaaggagctattatcagaagacaatcctccaaagtacagggagactactgttagggactatgttgcctacttcaatgagaaaggccttgatggtacctctgctttgtctcattttaatctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.49

Weight (kDa)

9.63

Isoelectric Point (pI)

7.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 221
AccB1I GGYRCC 1 cut(s) 221
AfaI GTAC 3 cut(s) 42, 164, 223
AgsI TTSAA 2 cut(s) 22, 202
AluBI AGCT 3 cut(s) 81, 115, 136
AluI AGCT 3 cut(s) 81, 115, 136
Alw21I GWGCWC 1 cut(s) 36
Alw26I GTCTC 2 cut(s) 164, 240
AoxI GGCC 1 cut(s) 211
ApeKI GCWGC 1 cut(s) 100
Asp718I GGTACC 1 cut(s) 221
AspS9I GGNCC 1 cut(s) 59
AvaII GGWCC 1 cut(s) 59
BanI GGYRCC 1 cut(s) 221
BbsI GAAGAC 1 cut(s) 153
Bbv12I GWGCWC 1 cut(s) 36
BbvI GCAGC 1 cut(s) 87
BccI CCATC 2 cut(s) 112, 212
BcoDI GTCTC 2 cut(s) 164, 240
BfmI CTRYAG 1 cut(s) 118
BisI GCNGC 1 cut(s) 101
BlsI GCNGC 1 cut(s) 102
Bme18I GGWCC 1 cut(s) 59
BmgT120I GGNCC 1 cut(s) 59
BmiI GGNNCC 1 cut(s) 223
BpiI GAAGAC 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 48
BseNI ACTGG 1 cut(s) 48
BseXI GCAGC 1 cut(s) 87
BshFI GGCC 1 cut(s) 213
BshNI GGYRCC 1 cut(s) 221
BsiHKAI GWGCWC 1 cut(s) 36
BslFI GGGAC 1 cut(s) 197
BsmAI GTCTC 2 cut(s) 164, 240
BsmFI GGGAC 1 cut(s) 197
BsmI GAATGC 1 cut(s) 102
BsnI GGCC 1 cut(s) 213
Bsp1286I GDGCHC 1 cut(s) 36
BspANI GGCC 1 cut(s) 213
BspLI GGNNCC 1 cut(s) 223
BspT107I GGYRCC 1 cut(s) 221
BsrI ACTGG 1 cut(s) 48
Bst4CI ACNGT 2 cut(s) 53, 178
BstC8I GCNNGC 1 cut(s) 79
BstMAI GTCTC 2 cut(s) 164, 240
BstMWI GCNNNNNNNGC 1 cut(s) 87
BstSFI CTRYAG 1 cut(s) 118
BstV1I GCAGC 1 cut(s) 87
BstV2I GAAGAC 1 cut(s) 153
BsuRI GGCC 1 cut(s) 213
Cac8I GCNNGC 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 59
Csp6I GTAC 3 cut(s) 41, 163, 222
CviJI RGCY 4 cut(s) 81, 115, 136, 213
CviKI_1 RGCY 4 cut(s) 81, 115, 136, 213
CviQI GTAC 3 cut(s) 41, 163, 222
Eco147I AGGCCT 1 cut(s) 213
Eco47I GGWCC 1 cut(s) 59
FaiI YATR 1 cut(s) 189
FaqI GGGAC 1 cut(s) 197
Fnu4HI GCNGC 1 cut(s) 101
Fsp4HI GCNGC 1 cut(s) 101
GluI GCNGC 1 cut(s) 101
HaeIII GGCC 1 cut(s) 213
HindIII AAGCTT 1 cut(s) 79
HinfI GANTC 1 cut(s) 18
Hpy188I TCNGA 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 22
HpyCH4III ACNGT 2 cut(s) 53, 178
HpyCH4V TGCA 1 cut(s) 77
HpyF10VI GCNNNNNNNGC 1 cut(s) 87
KpnI GGTACC 1 cut(s) 225
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 4 cut(s) 22, 29, 78, 151
Lsp1109I GCAGC 1 cut(s) 87
MboII GAAGA 1 cut(s) 158
MhlI GDGCHC 1 cut(s) 36
MnlI CCTC 2 cut(s) 165, 235
MseI TTAA 1 cut(s) 243
MslI CAYNNNNRTG 1 cut(s) 95
Mva1269I GAATGC 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 87
NlaIV GGNNCC 1 cut(s) 223
PceI AGGCCT 1 cut(s) 213
PctI GAATGC 1 cut(s) 102
PfeI GAWTC 1 cut(s) 18
PkrI GCNGC 1 cut(s) 102
PspN4I GGNNCC 1 cut(s) 223
PspPI GGNCC 1 cut(s) 59
RsaI GTAC 3 cut(s) 42, 164, 223
RsaNI GTAC 3 cut(s) 41, 163, 222
RseI CAYNNNNRTG 1 cut(s) 95
SaqAI TTAA 1 cut(s) 243
SatI GCNGC 1 cut(s) 101
Sau96I GGNCC 1 cut(s) 59
SduI GDGCHC 1 cut(s) 36
SetI ASST 5 cut(s) 61, 83, 117, 138, 227
SfcI CTRYAG 1 cut(s) 118
SgeI CNNG 9 cut(s) 34, 49, 56, 75, 90, 105, 142, 178, 227
SinI GGWCC 1 cut(s) 59
SmiMI CAYNNNNRTG 1 cut(s) 95
SseBI AGGCCT 1 cut(s) 213
StuI AGGCCT 1 cut(s) 213
TaaI ACNGT 2 cut(s) 53, 178
TaqI TCGA 1 cut(s) 107
TatI WGTACW 1 cut(s) 162
TfiI GAWTC 1 cut(s) 18
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TseI GCWGC 1 cut(s) 100
VpaK11BI GGWCC 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.