Rmu_sc0004928.1_g000001

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004928.1
Physical Location & Seq
Forward (+)
1 .. 468
468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004928.1_g000001.1.cds

Sequence Viewer

Length: 252 bp
cttatatcaaatgacagattcaagagtgtagaacacagggtgctggcaaaccatagaggtcccagaatctcagttgcaggttttttcagcacaggactgctgccattggcaaagctctacggaccaattaaggagatattatcagaagacaatcctccaaagtacagggagaccactttaagggactatgatgcatactacagagaaaaaagccttgatggcaggtctaccttgactcattataagctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.6

Weight (kDa)

9.52

Isoelectric Point (pI)

25.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 243
Acc36I ACCTGC 2 cut(s) 68, 213
AccI GTMKAC 1 cut(s) 227
AdeI CACNNNGTG 1 cut(s) 40
AfaI GTAC 1 cut(s) 164
AfiI CCNNNNNNNGG 1 cut(s) 180
AgsI TTSAA 1 cut(s) 22
AluBI AGCT 2 cut(s) 115, 247
AluI AGCT 2 cut(s) 115, 247
Alw26I GTCTC 1 cut(s) 164
ApeKI GCWGC 1 cut(s) 100
AspS9I GGNCC 2 cut(s) 59, 122
AvaII GGWCC 2 cut(s) 59, 122
BbsI GAAGAC 1 cut(s) 153
BbvI GCAGC 1 cut(s) 87
BccI CCATC 1 cut(s) 212
BcoDI GTCTC 1 cut(s) 164
BfmI CTRYAG 1 cut(s) 199
BfuAI ACCTGC 2 cut(s) 68, 213
BglI GCCNNNNNGGC 1 cut(s) 219
BisI GCNGC 1 cut(s) 101
BlsI GCNGC 1 cut(s) 102
Bme18I GGWCC 2 cut(s) 59, 122
BmgT120I GGNCC 2 cut(s) 59, 122
BmiI GGNNCC 1 cut(s) 61
BmsI GCATC 1 cut(s) 181
BpiI GAAGAC 1 cut(s) 153
BsaI GGTCTC 1 cut(s) 164
Bsc4I CCNNNNNNNGG 1 cut(s) 180
BseLI CCNNNNNNNGG 1 cut(s) 180
BseMII CTCAG 1 cut(s) 84
BseXI GCAGC 1 cut(s) 87
BslFI GGGAC 2 cut(s) 45, 197
BslI CCNNNNNNNGG 1 cut(s) 180
BsmAI GTCTC 1 cut(s) 164
BsmFI GGGAC 2 cut(s) 45, 197
Bso31I GGTCTC 1 cut(s) 164
BspCNI CTCAG 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 61
BspMI ACCTGC 2 cut(s) 68, 213
BspTNI GGTCTC 1 cut(s) 164
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 70
BstMAI GTCTC 1 cut(s) 164
BstMWI GCNNNNNNNGC 1 cut(s) 219
BstSFI CTRYAG 1 cut(s) 199
BstV1I GCAGC 1 cut(s) 87
BstV2I GAAGAC 1 cut(s) 153
BveI ACCTGC 2 cut(s) 68, 213
Cac8I GCNNGC 1 cut(s) 45
Cfr13I GGNCC 2 cut(s) 59, 122
Csp6I GTAC 1 cut(s) 163
CviJI RGCY 3 cut(s) 115, 213, 247
CviKI_1 RGCY 3 cut(s) 115, 213, 247
CviQI GTAC 1 cut(s) 163
DdeI CTNAG 1 cut(s) 70
DraIII CACNNNGTG 1 cut(s) 40
Eco31I GGTCTC 1 cut(s) 164
Eco47I GGWCC 2 cut(s) 59, 122
EcoO109I RGGNCCY 1 cut(s) 59
EcoT22I ATGCAT 1 cut(s) 196
FaiI YATR 5 cut(s) 5, 54, 189, 196, 243
FaqI GGGAC 2 cut(s) 45, 197
FblI GTMKAC 1 cut(s) 227
Fnu4HI GCNGC 1 cut(s) 101
Fsp4HI GCNGC 1 cut(s) 101
GluI GCNGC 1 cut(s) 101
HindIII AAGCTT 1 cut(s) 245
HinfI GANTC 3 cut(s) 18, 66, 235
Hpy166II GTNNAC 1 cut(s) 228
Hpy188I TCNGA 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 22
Hpy8I GTNNAC 1 cut(s) 228
HpyCH4V TGCA 2 cut(s) 77, 194
HpyF10VI GCNNNNNNNGC 1 cut(s) 219
HpyF3I CTNAG 1 cut(s) 70
LpnPI CCDG 7 cut(s) 22, 29, 63, 76, 78, 151, 208
Lsp1109I GCAGC 1 cut(s) 87
LweI GCATC 1 cut(s) 181
MboII GAAGA 1 cut(s) 158
MluCI AATT 1 cut(s) 126
MlyI GAGTC 1 cut(s) 229
MnlI CCTC 2 cut(s) 50, 165
Mph1103I ATGCAT 1 cut(s) 196
MseI TTAA 2 cut(s) 129, 179
MwoI GCNNNNNNNGC 1 cut(s) 219
NlaIV GGNNCC 1 cut(s) 61
NsiI ATGCAT 1 cut(s) 196
PfeI GAWTC 2 cut(s) 18, 66
PkrI GCNGC 1 cut(s) 102
PleI GAGTC 1 cut(s) 229
PpsI GAGTC 1 cut(s) 229
PpuMI RGGWCCY 1 cut(s) 59
PsiI TTATAA 1 cut(s) 243
Psp5II RGGWCCY 1 cut(s) 59
PspN4I GGNNCC 1 cut(s) 61
PspPI GGNCC 2 cut(s) 59, 122
PspPPI RGGWCCY 1 cut(s) 59
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
SaqAI TTAA 2 cut(s) 129, 179
SatI GCNGC 1 cut(s) 101
Sau96I GGNCC 2 cut(s) 59, 122
SchI GAGTC 1 cut(s) 229
SetI ASST 6 cut(s) 61, 82, 117, 227, 233, 249
SfaNI GCATC 1 cut(s) 181
SfcI CTRYAG 1 cut(s) 199
SinI GGWCC 2 cut(s) 59, 122
Sse9I AATT 1 cut(s) 126
TasI AATT 1 cut(s) 126
TatI WGTACW 1 cut(s) 162
TfiI GAWTC 2 cut(s) 18, 66
Tru1I TTAA 2 cut(s) 129, 179
Tru9I TTAA 2 cut(s) 129, 179
TseI GCWGC 1 cut(s) 100
TspGWI ACGGA 1 cut(s) 135
VpaK11BI GGWCC 2 cut(s) 59, 122
XmiI GTMKAC 1 cut(s) 227
Zsp2I ATGCAT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.