Rmu_co8456623.1_g000001

Calcium-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8456623.1
Physical Location & Seq
Forward (+)
393 .. 776
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8456623.1_g000001.1.cds

Sequence Viewer

Length: 231 bp
atggacactgataaagatggcaaagtaacttatgaggaattgaagagtggtcttcaaaaggttggttcgcagttggctgaaccagaggttaagatgctgatggaagtggttgatgttgatgggaatcaatttctggattatcgagagttcgcagcagttacaattcacttgcaaaaattggacattgatgaaaatctttggagagcatttgcattgggtatattgaattag

Protein Analysis

76

Amino Acids

8.64

Weight (kDa)

4.43

Isoelectric Point (pI)

17.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 43, 56, 226
ApeKI GCWGC 1 cut(s) 152
BbsI GAAGAC 1 cut(s) 44
BbvI GCAGC 1 cut(s) 164
BccI CCATC 3 cut(s) 11, 94, 113
BisI GCNGC 1 cut(s) 153
BlsI GCNGC 1 cut(s) 154
BmsI GCATC 1 cut(s) 84
BpiI GAAGAC 1 cut(s) 44
BsaBI GATNNNNATC 2 cut(s) 123, 192
Bse8I GATNNNNATC 2 cut(s) 123, 192
BseJI GATNNNNATC 2 cut(s) 123, 192
BseXI GCAGC 1 cut(s) 164
Bst6I CTCTTC 1 cut(s) 38
BstV1I GCAGC 1 cut(s) 164
BstV2I GAAGAC 1 cut(s) 44
BtsIMutI CAGTG 1 cut(s) 6
CviJI RGCY 1 cut(s) 77
CviKI_1 RGCY 1 cut(s) 77
Eam1104I CTCTTC 1 cut(s) 38
EarI CTCTTC 1 cut(s) 38
FaiI YATR 2 cut(s) 33, 221
Fnu4HI GCNGC 1 cut(s) 153
Fsp4HI GCNGC 1 cut(s) 153
GluI GCNGC 1 cut(s) 153
HinfI GANTC 1 cut(s) 124
Hpy188III TCNNGA 2 cut(s) 134, 143
HpyCH4V TGCA 2 cut(s) 172, 212
LpnPI CCDG 2 cut(s) 96, 119
Lsp1109I GCAGC 1 cut(s) 164
LweI GCATC 1 cut(s) 84
MaeIII GTNAC 2 cut(s) 25, 157
MboII GAAGA 2 cut(s) 44, 55
MluCI AATT 5 cut(s) 38, 128, 162, 176, 226
MnlI CCTC 2 cut(s) 28, 79
MseI TTAA 1 cut(s) 90
PfeI GAWTC 1 cut(s) 124
PkrI GCNGC 1 cut(s) 154
SaqAI TTAA 1 cut(s) 90
SatI GCNGC 1 cut(s) 153
SetI ASST 2 cut(s) 63, 90
SfaNI GCATC 1 cut(s) 84
SgeI CNNG 4 cut(s) 95, 146, 155, 181
Sse9I AATT 5 cut(s) 38, 128, 162, 176, 226
TaqI TCGA 1 cut(s) 142
TasI AATT 5 cut(s) 38, 128, 162, 176, 226
TfiI GAWTC 1 cut(s) 124
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 1 cut(s) 13
TseI GCWGC 1 cut(s) 152
TspDTI ATGAA 1 cut(s) 204
TspRI CASTG 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.