Rmu_sc0002799.1_g000014

acetyltransferase component of pyruvate dehydrogenase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002799.1
Physical Location & Seq
Reverse (-)
88892 .. 89176
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002799.1_g000014.1.cds

Sequence Viewer

Length: 204 bp
atgactgccttgcctgctaaggcacttgctcagcacccagttgtaaatgccagctgcaggtatgaaaaaagcttttactacaacagtagcacaaacatcgccattgctgcagataagttggatttgtatttgttatctcagaagtggaaagagctgatggagaaggatggagaaggctcgctcaaaccaacttcagccccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.41

Weight (kDa)

7.84

Isoelectric Point (pI)

32.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 48
AcuI CTGAAG 1 cut(s) 177
AfiI CCNNNNNNNGG 1 cut(s) 57
AluBI AGCT 3 cut(s) 54, 72, 154
AluI AGCT 3 cut(s) 54, 72, 154
ApeKI GCWGC 2 cut(s) 54, 107
BbvI GCAGC 2 cut(s) 41, 94
BccI CCATC 2 cut(s) 151, 161
BcgI CGANNNNNNTGC 2 cut(s) 79, 113
BfmI CTRYAG 2 cut(s) 55, 108
BfuAI ACCTGC 1 cut(s) 48
BisI GCNGC 2 cut(s) 55, 108
BlpI GCTNAGC 1 cut(s) 30
BlsI GCNGC 2 cut(s) 56, 109
BmrI ACTGGG 1 cut(s) 32
BmuI ACTGGG 1 cut(s) 32
Bpu10I CCTNAGC 1 cut(s) 18
Bpu1102I GCTNAGC 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 57
Bse1I ACTGG 1 cut(s) 38
Bse3DI GCAATG 1 cut(s) 102
BseGI GGATG 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 57
BseMI GCAATG 1 cut(s) 102
BseMII CTCAG 2 cut(s) 44, 152
BseNI ACTGG 1 cut(s) 38
BseXI GCAGC 2 cut(s) 41, 94
BslI CCNNNNNNNGG 1 cut(s) 57
Bsp1720I GCTNAGC 1 cut(s) 30
BspCNI CTCAG 2 cut(s) 43, 151
BspMAI CTGCAG 2 cut(s) 59, 112
BspMI ACCTGC 1 cut(s) 48
BsrDI GCAATG 1 cut(s) 102
BsrI ACTGG 1 cut(s) 38
Bst4CI ACNGT 1 cut(s) 86
BstC8I GCNNGC 3 cut(s) 15, 52, 179
BstDEI CTNAG 3 cut(s) 18, 30, 138
BstF5I GGATG 1 cut(s) 172
BstMWI GCNNNNNNNGC 2 cut(s) 14, 107
BstSFI CTRYAG 2 cut(s) 55, 108
BstV1I GCAGC 2 cut(s) 41, 94
BtgZI GCGATG 1 cut(s) 82
BtsCI GGATG 1 cut(s) 172
BveI ACCTGC 1 cut(s) 48
Cac8I GCNNGC 3 cut(s) 15, 52, 179
CviJI RGCY 5 cut(s) 54, 72, 154, 177, 197
CviKI_1 RGCY 5 cut(s) 54, 72, 154, 177, 197
DdeI CTNAG 3 cut(s) 18, 30, 138
Eco57I CTGAAG 1 cut(s) 177
FaiI YATR 2 cut(s) 63, 202
Fnu4HI GCNGC 2 cut(s) 55, 108
FokI GGATG 1 cut(s) 179
Fsp4HI GCNGC 2 cut(s) 55, 108
GluI GCNGC 2 cut(s) 55, 108
HindIII AAGCTT 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 141
HpyAV CCTTC 2 cut(s) 157, 167
HpyCH4III ACNGT 1 cut(s) 86
HpyCH4V TGCA 2 cut(s) 57, 110
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 107
HpyF3I CTNAG 3 cut(s) 18, 30, 138
LpnPI CCDG 4 cut(s) 27, 43, 51, 64
Lsp1109I GCAGC 2 cut(s) 41, 94
MmeI TCCRAC 1 cut(s) 99
MspA1I CMGCKG 1 cut(s) 54
MwoI GCNNNNNNNGC 2 cut(s) 14, 107
PkrI GCNGC 2 cut(s) 56, 109
PstI CTGCAG 2 cut(s) 59, 112
PvuII CAGCTG 1 cut(s) 54
SatI GCNGC 2 cut(s) 55, 108
SetI ASST 4 cut(s) 56, 62, 74, 156
SfcI CTRYAG 2 cut(s) 55, 108
SgeI CNNG 7 cut(s) 22, 26, 38, 50, 63, 70, 190
TaaI ACNGT 1 cut(s) 86
TseI GCWGC 2 cut(s) 54, 107
TspDTI ATGAA 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.