Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014039.1

Orthogroup ID

OG0008160

Physical Location & Seq

Genomic Coordinates Reverse (-)

19110 .. 19804

Gene Structure 695 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014039.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

atggaaagagaggaaaatttaattgcagccttttccttttttgacaaagattctagtggttacattaccattgatgagcttcaacaagcttgcaaagacttcggtctaggtgatgttcatctggatgatatgatcaaagaaattgatcaggataatgatgggcgtattgactacggggagtttgctgcaatgatgaagaagggtggtgatcatggtactatagggaggaacagaactgcttctcgcaatttgaactttaatttggctgatgcttttggaataaaagagtctgcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001558 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004683 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009787 GO:0009789 GO:0009931 GO:0009966 GO:0009967 GO:0009987 GO:0010646 GO:0010647 GO:0010769 GO:0010857 GO:0010959 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0018105 GO:0018193 GO:0018209 GO:0019538 GO:0022603 GO:0022604 GO:0022898 GO:0023051 GO:0023052 GO:0023056 GO:0032409 GO:0032412 GO:0032879 GO:0034762 GO:0034765 GO:0035556 GO:0036211 GO:0040008 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043266 GO:0043269 GO:0043412 GO:0043900 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0045595 GO:0046777 GO:0048518 GO:0048522 GO:0048583 GO:0048584 GO:0048638 GO:0050789 GO:0050793 GO:0050794 GO:0050896 GO:0051049 GO:0051128 GO:0051239 GO:0051510 GO:0051716 GO:0060284 GO:0065007 GO:0065009 GO:0071704 GO:0071944 GO:0080092 GO:0140096 GO:1901016 GO:1901379 GO:1901419 GO:1901421 GO:1901564 GO:1901979 GO:1904062 GO:1905957 GO:1905959 GO:2000241 GO:2001257

KEGG Pathways

Metabolic & Signaling

ko04626 ko05145 map04626 map05145

Pfam Domains

Protein Families

EF-hand_1 EF-hand_5 EF-hand_6 Pkinase

Protein Analysis

98

Amino Acids

10.93

Weight (kDa)

4.47

Isoelectric Point (pI)

27.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008160)

Species	Orthologous Gene IDs
malus_domestica	MD07G1063200.v1.1
pyrus_communis	pycom02g21820 pycom02g21840
rosa_chinensis	RchiOBHm_Chr3g0470181
rosa_laevigata	RLG00000008106 RLG00000029152 RLG00000031580 RLG00000034936
rosa_multiflora	Rmu_co8301435.1_g000001 Rmu_co8456623.1_g000001 Rmu_sc0002799.1_g000014 Rmu_sc0014039.1_g000005
rosa_roxburghii	Rroxscaffold_3G00272930
rosa_rugosa	Rorug02G0162400 Rorug04G0088700
rosa_samantha	Rh1AG124000 Rh2BG466300 Rh3BG244000 Rh3CG171600 Rh4AG140600 Rh5BG342900 Rh5CG369900 Rh6AG182300 Rh7BG390200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	16
AfaI	GTAC	1 cut(s)	217
AgsI	TTSAA	2 cut(s)	83, 253
AjuI	GAANNNNNNNTTGG	2 cut(s)	245, 277
AluBI	AGCT	2 cut(s)	79, 89
AluI	AGCT	2 cut(s)	79, 89
ApeKI	GCWGC	2 cut(s)	26, 185
ApoI	RAATTY	1 cut(s)	16
Asp700I	GAANNNNTTC	1 cut(s)	238
AsuHPI	GGTGA	2 cut(s)	122, 218
BbvI	GCAGC	2 cut(s)	38, 172
BccI	CCATC	1 cut(s)	152
BcgI	CGANNNNNNTGC	2 cut(s)	82, 116
BclI	TGATCA	3 cut(s)	132, 145, 208
BfaI	CTAG	2 cut(s)	54, 107
BfmI	CTRYAG	1 cut(s)	219
BisI	GCNGC	2 cut(s)	27, 186
BlsI	GCNGC	2 cut(s)	28, 187
BmsI	GCATC	1 cut(s)	259
BoxI	GACNNNNGTC	1 cut(s)	102
BsaBI	GATNNNNATC	1 cut(s)	117
Bse3DI	GCAATG	1 cut(s)	195
Bse8I	GATNNNNATC	1 cut(s)	117
BseGI	GGATG	1 cut(s)	130
BseJI	GATNNNNATC	1 cut(s)	117
BseMI	GCAATG	1 cut(s)	195
BseXI	GCAGC	2 cut(s)	38, 172
Bsp143I	GATC	3 cut(s)	132, 145, 208
BsrDI	GCAATG	1 cut(s)	195
BssMI	GATC	3 cut(s)	132, 145, 208
BstC8I	GCNNGC	1 cut(s)	91
BstF5I	GGATG	1 cut(s)	130
BstKTI	GATC	3 cut(s)	135, 148, 211
BstMBI	GATC	3 cut(s)	132, 145, 208
BstPAI	GACNNNNGTC	1 cut(s)	102
BstSFI	CTRYAG	1 cut(s)	219
BstV1I	GCAGC	2 cut(s)	38, 172
BtsCI	GGATG	1 cut(s)	130
Cac8I	GCNNGC	1 cut(s)	91
Csp6I	GTAC	1 cut(s)	216
CviAII	CATG	2 cut(s)	212, 294
CviJI	RGCY	4 cut(s)	29, 79, 89, 266
CviKI_1	RGCY	4 cut(s)	29, 79, 89, 266
CviQI	GTAC	1 cut(s)	216
DpnI	GATC	3 cut(s)	134, 147, 210
DpnII	GATC	3 cut(s)	132, 145, 208
FaeI	CATG	2 cut(s)	215, 297
FaiI	YATR	4 cut(s)	131, 213, 221, 295
FatI	CATG	2 cut(s)	211, 293
FbaI	TGATCA	3 cut(s)	132, 145, 208
Fnu4HI	GCNGC	2 cut(s)	27, 186
FokI	GGATG	1 cut(s)	137
Fsp4HI	GCNGC	2 cut(s)	27, 186
FspBI	CTAG	2 cut(s)	54, 107
GluI	GCNGC	2 cut(s)	27, 186
Hin1II	CATG	2 cut(s)	215, 297
HindIII	AAGCTT	1 cut(s)	87
HinfI	GANTC	2 cut(s)	50, 287
HphI	GGTGA	2 cut(s)	122, 218
Hpy188III	TCNNGA	2 cut(s)	122, 149
HpyAV	CCTTC	1 cut(s)	193
HpyCH4V	TGCA	4 cut(s)	26, 93, 188, 293
Hsp92II	CATG	2 cut(s)	215, 297
Ksp22I	TGATCA	3 cut(s)	132, 145, 208
Kzo9I	GATC	3 cut(s)	132, 145, 208
LpnPI	CCDG	2 cut(s)	107, 134
Lsp1109I	GCAGC	2 cut(s)	38, 172
LweI	GCATC	1 cut(s)	259
MaeI	CTAG	2 cut(s)	54, 107
MaeIII	GTNAC	1 cut(s)	59
MalI	GATC	3 cut(s)	134, 147, 210
MboI	GATC	3 cut(s)	132, 145, 208
MboII	GAAGA	1 cut(s)	208
MluCI	AATT	5 cut(s)	16, 21, 141, 247, 259
MlyI	GAGTC	1 cut(s)	296
MnlI	CCTC	2 cut(s)	4, 219
MroXI	GAANNNNTTC	1 cut(s)	238
MseI	TTAA	2 cut(s)	20, 258
MslI	CAYNNNNRTG	1 cut(s)	123
NdeII	GATC	3 cut(s)	132, 145, 208
NlaIII	CATG	2 cut(s)	215, 297
PdmI	GAANNNNTTC	1 cut(s)	238
PfeI	GAWTC	1 cut(s)	50
PkrI	GCNGC	2 cut(s)	28, 187
PleI	GAGTC	1 cut(s)	295
PpsI	GAGTC	1 cut(s)	295
PshAI	GACNNNNGTC	1 cut(s)	102
RsaI	GTAC	1 cut(s)	217
RsaNI	GTAC	1 cut(s)	216
RseI	CAYNNNNRTG	1 cut(s)	123
SaqAI	TTAA	2 cut(s)	20, 258
SatI	GCNGC	2 cut(s)	27, 186
Sau3AI	GATC	3 cut(s)	132, 145, 208
SchI	GAGTC	1 cut(s)	296
SetI	ASST	3 cut(s)	81, 91, 112
SfaNI	GCATC	1 cut(s)	259
SfcI	CTRYAG	1 cut(s)	219
SgeI	CNNG	9 cut(s)	66, 98, 102, 119, 134, 161, 187, 224, 255
SmiMI	CAYNNNNRTG	1 cut(s)	123
Sse9I	AATT	5 cut(s)	16, 21, 141, 247, 259
SspMI	CTAG	2 cut(s)	54, 107
TaqII	GACCGA	1 cut(s)	92
TasI	AATT	5 cut(s)	16, 21, 141, 247, 259
TfiI	GAWTC	1 cut(s)	50
Tru1I	TTAA	2 cut(s)	20, 258
Tru9I	TTAA	2 cut(s)	20, 258
TseI	GCWGC	2 cut(s)	26, 185
TspDTI	ATGAA	2 cut(s)	107, 209
XapI	RAATTY	1 cut(s)	16
XmnI	GAANNNNTTC	1 cut(s)	238
XspI	CTAG	2 cut(s)	54, 107

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.