Rmu_co8459821.1_g000001

Ras-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8459821.1
Physical Location & Seq
Reverse (-)
341 .. 1432
1092 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8459821.1_g000001.1.cds

Sequence Viewer

Length: 420 bp
atggcatgtcatgccactggtactgataagatggcattttcgtttactcttaggagagaaacttttaatcacttggctagttggctagaggatgcaaggcagcatgcaaatgcaaacatgaccattatgttaattggtaataagtgtgatcttgctcatagacgagctgtgagcacagaggaaggggaacaatttgcaaaggaacatggattgatcttcatggaggcctctgctaaaactgctcagaatgttgaggaggcattcataaaaactgctgcaaccatatacaagaagattcaagatggcgtttttgatgtatcaaatgagtcttatggcataaaagtcggatatgggggaattccaggaccatcaggaggcagagatggttcttcctctcaagctggaggctgttgcagttga

Protein Analysis

139

Amino Acids

14.95

Weight (kDa)

6.19

Isoelectric Point (pI)

44.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 357
AfaI GTAC 1 cut(s) 22
AfiI CCNNNNNNNGG 1 cut(s) 374
AgsI TTSAA 1 cut(s) 299
AjnI CCWGG 1 cut(s) 361
AluBI AGCT 2 cut(s) 167, 401
AluI AGCT 2 cut(s) 167, 401
Alw21I GWGCWC 1 cut(s) 176
AoxI GGCC 1 cut(s) 225
ApeKI GCWGC 2 cut(s) 100, 275
ApoI RAATTY 1 cut(s) 357
AspS9I GGNCC 1 cut(s) 365
AvaII GGWCC 1 cut(s) 365
Bbv12I GWGCWC 1 cut(s) 176
BbvI GCAGC 2 cut(s) 112, 262
BccI CCATC 4 cut(s) 25, 296, 376, 377
BcgI CGANNNNNNTGC 2 cut(s) 325, 359
BciT130I CCWGG 1 cut(s) 363
BfaI CTAG 2 cut(s) 78, 86
BisI GCNGC 2 cut(s) 101, 276
BlsI GCNGC 2 cut(s) 102, 277
Bme1390I CCNGG 1 cut(s) 363
Bme18I GGWCC 1 cut(s) 365
BmgT120I GGNCC 1 cut(s) 365
BmrFI CCNGG 1 cut(s) 363
BmsI GCATC 1 cut(s) 82
BpuEI CTTGAG 1 cut(s) 381
Bsc4I CCNNNNNNNGG 1 cut(s) 374
Bse1I ACTGG 1 cut(s) 22
BseBI CCWGG 1 cut(s) 363
BseGI GGATG 1 cut(s) 97
BseLI CCNNNNNNNGG 1 cut(s) 374
BseMII CTCAG 1 cut(s) 257
BseNI ACTGG 1 cut(s) 22
BseRI GAGGAG 1 cut(s) 269
BseXI GCAGC 2 cut(s) 112, 262
BshFI GGCC 1 cut(s) 227
BsiHKAI GWGCWC 1 cut(s) 176
BslI CCNNNNNNNGG 1 cut(s) 374
BsmI GAATGC 1 cut(s) 260
BsnI GGCC 1 cut(s) 227
Bsp1286I GDGCHC 1 cut(s) 176
Bsp143I GATC 2 cut(s) 148, 213
BspANI GGCC 1 cut(s) 227
BspCNI CTCAG 1 cut(s) 256
BsrI ACTGG 1 cut(s) 22
BssMI GATC 2 cut(s) 148, 213
Bst2UI CCWGG 1 cut(s) 363
BstAPI GCANNNNNTGC 1 cut(s) 11
BstC8I GCNNGC 1 cut(s) 105
BstDEI CTNAG 2 cut(s) 50, 243
BstF5I GGATG 1 cut(s) 97
BstKTI GATC 2 cut(s) 151, 216
BstMBI GATC 2 cut(s) 148, 213
BstMWI GCNNNNNNNGC 2 cut(s) 11, 239
BstNI CCWGG 1 cut(s) 363
BstNSI RCATGY 2 cut(s) 9, 107
BstSCI CCNGG 1 cut(s) 361
BstV1I GCAGC 2 cut(s) 112, 262
BsuRI GGCC 1 cut(s) 227
BtsCI GGATG 1 cut(s) 97
BtsIMutI CAGTG 1 cut(s) 15
Cac8I GCNNGC 1 cut(s) 105
Cfr13I GGNCC 1 cut(s) 365
Csp6I GTAC 1 cut(s) 21
CviAII CATG 6 cut(s) 6, 11, 104, 118, 206, 220
CviJI RGCY 6 cut(s) 77, 85, 167, 227, 401, 408
CviKI_1 RGCY 6 cut(s) 77, 85, 167, 227, 401, 408
CviQI GTAC 1 cut(s) 21
DdeI CTNAG 2 cut(s) 50, 243
DpnI GATC 2 cut(s) 150, 215
DpnII GATC 2 cut(s) 148, 213
Eco147I AGGCCT 1 cut(s) 227
Eco47I GGWCC 1 cut(s) 365
EcoRI GAATTC 1 cut(s) 357
EcoRII CCWGG 1 cut(s) 361
FaeI CATG 6 cut(s) 9, 14, 107, 121, 209, 223
FatI CATG 6 cut(s) 5, 10, 103, 117, 205, 219
Fnu4HI GCNGC 2 cut(s) 101, 276
FokI GGATG 1 cut(s) 104
Fsp4HI GCNGC 2 cut(s) 101, 276
FspBI CTAG 2 cut(s) 78, 86
GluI GCNGC 2 cut(s) 101, 276
HaeIII GGCC 1 cut(s) 227
Hin1II CATG 6 cut(s) 9, 14, 107, 121, 209, 223
HinfI GANTC 2 cut(s) 295, 326
Hpy166II GTNNAC 1 cut(s) 45
Hpy188I TCNGA 2 cut(s) 246, 347
Hpy188III TCNNGA 2 cut(s) 299, 372
Hpy8I GTNNAC 1 cut(s) 45
HpyAV CCTTC 1 cut(s) 176
HpyCH4V TGCA 6 cut(s) 95, 107, 113, 197, 278, 414
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 239
HpyF3I CTNAG 2 cut(s) 50, 243
Hsp92II CATG 6 cut(s) 9, 14, 107, 121, 209, 223
Kzo9I GATC 2 cut(s) 148, 213
LpnPI CCDG 5 cut(s) 3, 348, 357, 375, 387
Lsp1109I GCAGC 2 cut(s) 112, 262
LweI GCATC 1 cut(s) 82
MaeI CTAG 2 cut(s) 78, 86
MalI GATC 2 cut(s) 150, 215
MboI GATC 2 cut(s) 148, 213
MboII GAAGA 3 cut(s) 208, 304, 381
MhlI GDGCHC 1 cut(s) 176
MluCI AATT 3 cut(s) 132, 191, 357
MlyI GAGTC 1 cut(s) 335
MmeI TCCRAC 1 cut(s) 325
MnlI CCTC 9 cut(s) 82, 172, 217, 238, 247, 250, 368, 398, 403
MseI TTAA 2 cut(s) 66, 131
MslI CAYNNNNRTG 1 cut(s) 108
MspR9I CCNGG 1 cut(s) 363
Mva1269I GAATGC 1 cut(s) 260
MvaI CCWGG 1 cut(s) 363
MwoI GCNNNNNNNGC 2 cut(s) 11, 239
NdeII GATC 2 cut(s) 148, 213
NlaIII CATG 6 cut(s) 9, 14, 107, 121, 209, 223
NspI RCATGY 2 cut(s) 9, 107
PaeI GCATGC 1 cut(s) 107
PceI AGGCCT 1 cut(s) 227
PctI GAATGC 1 cut(s) 260
PfeI GAWTC 1 cut(s) 295
PfoI TCCNGGA 1 cut(s) 361
PkrI GCNGC 2 cut(s) 102, 277
PleI GAGTC 1 cut(s) 334
PpsI GAGTC 1 cut(s) 334
Psp6I CCWGG 1 cut(s) 361
PspGI CCWGG 1 cut(s) 361
PspPI GGNCC 1 cut(s) 365
RsaI GTAC 1 cut(s) 22
RsaNI GTAC 1 cut(s) 21
RseI CAYNNNNRTG 1 cut(s) 108
SaqAI TTAA 2 cut(s) 66, 131
SatI GCNGC 2 cut(s) 101, 276
Sau3AI GATC 2 cut(s) 148, 213
Sau96I GGNCC 1 cut(s) 365
SchI GAGTC 1 cut(s) 335
ScrFI CCNGG 1 cut(s) 363
SduI GDGCHC 1 cut(s) 176
SetI ASST 2 cut(s) 169, 403
SfaNI GCATC 1 cut(s) 82
SinI GGWCC 1 cut(s) 365
SmiMI CAYNNNNRTG 1 cut(s) 108
SmlI CTYRAG 1 cut(s) 396
SmoI CTYRAG 1 cut(s) 396
SphI GCATGC 1 cut(s) 107
Sse9I AATT 3 cut(s) 132, 191, 357
SseBI AGGCCT 1 cut(s) 227
SspMI CTAG 2 cut(s) 78, 86
StuI AGGCCT 1 cut(s) 227
StyD4I CCNGG 1 cut(s) 361
TasI AATT 3 cut(s) 132, 191, 357
TfiI GAWTC 1 cut(s) 295
Tru1I TTAA 2 cut(s) 66, 131
Tru9I TTAA 2 cut(s) 66, 131
TscAI CASTG 1 cut(s) 22
TseI GCWGC 2 cut(s) 100, 275
TspDTI ATGAA 2 cut(s) 208, 253
TspRI CASTG 1 cut(s) 22
VpaK11BI GGWCC 1 cut(s) 365
XapI RAATTY 1 cut(s) 357
XceI RCATGY 2 cut(s) 9, 107
XspI CTAG 2 cut(s) 78, 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.