Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8468425.1

Orthogroup ID

OG0005599

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1967

Gene Structure 1967 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8468425.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 568 bp

agttgcagttgatgatgactcgggcaggaaacccagtttgattaaccagttcttcctctctcatcattctcctcggtctctcagctgcgagtacaagtcagatgcgaggcacttgatcgatatccttctccttctcatcatcatctcgctcaacgtggcaattcttcagttcatcaacaaacgcttccagcccgtgcatgatttgactattggcgttgagtttggggctaggatgatcaccatcgataacaaaccattcaagctccaaatttgggacacggcaggagctgctggcactttgcttgtctacgacatcaccagctggctagaggatgcgaggcagcatgcaaatgcaaacatgaccataatgttaattggtagtaagtgtgatcttgctcgtagacaagctgtgagcacagaggaaggggagcaatttgcaaaggaacatcgattgatcttcatggaggcctctgctaaaactgcccagaatgttgaggaggcattcataaaaaccgctgcaaccatgtacaagaagattcaagatggcgtttttgatgtatcaaatgag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005773 GO:0005886 GO:0006810 GO:0006888 GO:0008150 GO:0012505 GO:0016020 GO:0016192 GO:0030100 GO:0031410 GO:0031982 GO:0032879 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0046907 GO:0048193 GO:0050789 GO:0050794 GO:0051049 GO:0051128 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0060627 GO:0065007 GO:0071944 GO:0097708

KEGG Pathways

Metabolic & Signaling

ko04152 map04152

Pfam Domains

Protein Families

Ras

Protein Analysis

189

Amino Acids

21.24

Weight (kDa)

5.87

Isoelectric Point (pI)

40.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005599)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G17160
fragaria_vesca	FvH4_3g00140
malus_domestica	MD05G1363800.v1.1 MD10G1341700.v1.1
prunus_persica	Prupe.4G001600_v2.0.a1 Prupe.4G001600_v2.0.a1 Prupe.4G001600_v2.0.a1
pyrus_communis	pycom05g32990 pycom10g29100
rosa_chinensis	RchiOBHm_Chr4g0425891 RchiOBHm_Chr5g0000191
rosa_laevigata	RLG00000018515 RLG00000030849
rosa_multiflora	Rmu_co8459821.1_g000001 Rmu_co8468425.1_g000001 Rmu_ssc0000243.1_g000011
rosa_roxburghii	Rroxscaffold_1G00075900 Rroxscaffold_2G00088190
rosa_rugosa	Rorug01G0341700 Rorug04G0382500
rosa_samantha	Rh2AG134900 Rh5CG001600 Rh5CG499000 Rh5DG001500 Rh6CG032700 Rh7DG362100
rosa_wichuraiana	Rw1G021010 Rw5G000180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	307, 401
AciI	CCGC	1 cut(s)	514
AcsI	RAATTY	1 cut(s)	268
AcuI	CTGAAG	1 cut(s)	150
AfaI	GTAC	2 cut(s)	93, 528
AfiI	CCNNNNNNNGG	1 cut(s)	272
AgsI	TTSAA	2 cut(s)	260, 540
AluBI	AGCT	5 cut(s)	85, 263, 288, 322, 408
AluI	AGCT	5 cut(s)	85, 263, 288, 322, 408
Alw21I	GWGCWC	1 cut(s)	417
Alw26I	GTCTC	1 cut(s)	82
AlwNI	CAGNNNCTG	1 cut(s)	288
Ama87I	CYCGRG	1 cut(s)	20
AoxI	GGCC	1 cut(s)	466
ApeKI	GCWGC	4 cut(s)	85, 288, 341, 516
ApoI	RAATTY	1 cut(s)	268
AsuHPI	GGTGA	2 cut(s)	230, 308
AvaI	CYCGRG	1 cut(s)	20
Bbv12I	GWGCWC	1 cut(s)	417
BbvI	GCAGC	4 cut(s)	72, 275, 353, 503
BccI	CCATC	2 cut(s)	249, 537
BceAI	ACGGC	1 cut(s)	295
BclI	TGATCA	1 cut(s)	235
BcoDI	GTCTC	1 cut(s)	82
BfaI	CTAG	2 cut(s)	229, 327
BisI	GCNGC	4 cut(s)	86, 289, 342, 517
BlsI	GCNGC	4 cut(s)	87, 290, 343, 518
BmeT110I	CYCGRG	1 cut(s)	20
BmrI	ACTGGG	1 cut(s)	28
BmsI	GCATC	2 cut(s)	92, 323
BmuI	ACTGGG	1 cut(s)	28
Bsa29I	ATCGAT	3 cut(s)	118, 244, 449
BsaBI	GATNNNNATC	2 cut(s)	120, 240
BsaI	GGTCTC	1 cut(s)	82
BsaJI	CCNNGG	1 cut(s)	72
Bsc4I	CCNNNNNNNGG	1 cut(s)	272
Bse1I	ACTGG	2 cut(s)	34, 47
Bse8I	GATNNNNATC	2 cut(s)	120, 240
BseCI	ATCGAT	3 cut(s)	118, 244, 449
BseDI	CCNNGG	1 cut(s)	72
BseGI	GGATG	2 cut(s)	238, 338
BseJI	GATNNNNATC	2 cut(s)	120, 240
BseLI	CCNNNNNNNGG	1 cut(s)	272
BseMII	CTCAG	1 cut(s)	95
BseNI	ACTGG	2 cut(s)	34, 47
BseRI	GAGGAG	2 cut(s)	61, 510
BseXI	GCAGC	4 cut(s)	72, 275, 353, 503
BshFI	GGCC	1 cut(s)	468
BshVI	ATCGAT	3 cut(s)	118, 244, 449
BsiHKAI	GWGCWC	1 cut(s)	417
BsiHKCI	CYCGRG	1 cut(s)	20
BslFI	GGGAC	1 cut(s)	288
BslI	CCNNNNNNNGG	1 cut(s)	272
BsmAI	GTCTC	1 cut(s)	82
BsmFI	GGGAC	1 cut(s)	288
BsmI	GAATGC	1 cut(s)	501
BsnI	GGCC	1 cut(s)	468
Bso31I	GGTCTC	1 cut(s)	82
BsoBI	CYCGRG	1 cut(s)	20
Bsp1286I	GDGCHC	1 cut(s)	417
Bsp1407I	TGTACA	1 cut(s)	526
Bsp143I	GATC	4 cut(s)	115, 235, 389, 454
BspACI	CCGC	1 cut(s)	514
BspANI	GGCC	1 cut(s)	468
BspCNI	CTCAG	1 cut(s)	94
BspDI	ATCGAT	3 cut(s)	118, 244, 449
BspTNI	GGTCTC	1 cut(s)	82
BsrGI	TGTACA	1 cut(s)	526
BsrI	ACTGG	2 cut(s)	34, 47
BssECI	CCNNGG	1 cut(s)	72
BssMI	GATC	4 cut(s)	115, 235, 389, 454
BstAPI	GCANNNNNTGC	1 cut(s)	288
BstAUI	TGTACA	1 cut(s)	526
BstC8I	GCNNGC	3 cut(s)	293, 324, 346
BstDEI	CTNAG	1 cut(s)	81
BstF5I	GGATG	2 cut(s)	238, 338
BstKTI	GATC	4 cut(s)	118, 238, 392, 457
BstMAI	GTCTC	1 cut(s)	82
BstMBI	GATC	4 cut(s)	115, 235, 389, 454
BstMWI	GCNNNNNNNGC	2 cut(s)	288, 480
BstNSI	RCATGY	1 cut(s)	348
BstV1I	GCAGC	4 cut(s)	72, 275, 353, 503
Bsu15I	ATCGAT	3 cut(s)	118, 244, 449
BsuRI	GGCC	1 cut(s)	468
BsuTUI	ATCGAT	3 cut(s)	118, 244, 449
BtsCI	GGATG	2 cut(s)	238, 338
Cac8I	GCNNGC	3 cut(s)	293, 324, 346
CaiI	CAGNNNCTG	1 cut(s)	288
ClaI	ATCGAT	3 cut(s)	118, 244, 449
Csp6I	GTAC	2 cut(s)	92, 527
CviAII	CATG	5 cut(s)	198, 345, 359, 461, 524
CviJI	RGCY	9 cut(s)	85, 191, 228, 263, 288, 322, 326, 408, 468
CviKI_1	RGCY	9 cut(s)	85, 191, 228, 263, 288, 322, 326, 408, 468
CviQI	GTAC	2 cut(s)	92, 527
DdeI	CTNAG	1 cut(s)	81
DpnI	GATC	4 cut(s)	117, 237, 391, 456
DpnII	GATC	4 cut(s)	115, 235, 389, 454
Eco147I	AGGCCT	1 cut(s)	468
Eco31I	GGTCTC	1 cut(s)	82
Eco32I	GATATC	1 cut(s)	122
Eco57I	CTGAAG	1 cut(s)	150
Eco88I	CYCGRG	1 cut(s)	20
EcoRV	GATATC	1 cut(s)	122
FaeI	CATG	5 cut(s)	201, 348, 362, 464, 527
FaiI	YATR	7 cut(s)	199, 346, 360, 366, 462, 507, 525
FaqI	GGGAC	1 cut(s)	288
FatI	CATG	5 cut(s)	197, 344, 358, 460, 523
FbaI	TGATCA	1 cut(s)	235
FblI	GTMKAC	2 cut(s)	307, 401
Fnu4HI	GCNGC	4 cut(s)	86, 289, 342, 517
FokI	GGATG	2 cut(s)	245, 345
Fsp4HI	GCNGC	4 cut(s)	86, 289, 342, 517
FspBI	CTAG	2 cut(s)	229, 327
GluI	GCNGC	4 cut(s)	86, 289, 342, 517
HaeIII	GGCC	1 cut(s)	468
Hin1II	CATG	5 cut(s)	201, 348, 362, 464, 527
HinfI	GANTC	2 cut(s)	18, 536
HphI	GGTGA	2 cut(s)	230, 308
Hpy166II	GTNNAC	2 cut(s)	308, 402
Hpy188I	TCNGA	1 cut(s)	101
Hpy188III	TCNNGA	1 cut(s)	540
Hpy8I	GTNNAC	2 cut(s)	308, 402
HpyAV	CCTTC	3 cut(s)	135, 141, 417
HpyCH4IV	ACGT	1 cut(s)	154
HpyCH4V	TGCA	6 cut(s)	6, 197, 348, 354, 438, 519
HpyF10VI	GCNNNNNNNGC	2 cut(s)	288, 480
HpyF3I	CTNAG	1 cut(s)	81
HpySE526I	ACGT	1 cut(s)	154
Hsp92II	CATG	5 cut(s)	201, 348, 362, 464, 527
Ksp22I	TGATCA	1 cut(s)	235
Kzo9I	GATC	4 cut(s)	115, 235, 389, 454
LmnI	GCTCC	3 cut(s)	268, 285, 428
LpnPI	CCDG	9 cut(s)	11, 47, 60, 201, 268, 277, 308, 332, 498
Lsp1109I	GCAGC	4 cut(s)	72, 275, 353, 503
LweI	GCATC	2 cut(s)	92, 323
MaeI	CTAG	2 cut(s)	229, 327
MaeII	ACGT	1 cut(s)	154
MalI	GATC	4 cut(s)	117, 237, 391, 456
MboI	GATC	4 cut(s)	115, 235, 389, 454
MboII	GAAGA	4 cut(s)	44, 156, 449, 545
MhlI	GDGCHC	1 cut(s)	417
MluCI	AATT	4 cut(s)	160, 268, 373, 432
MlyI	GAGTC	1 cut(s)	12
MseI	TTAA	2 cut(s)	43, 372
MslI	CAYNNNNRTG	1 cut(s)	349
MspA1I	CMGCKG	3 cut(s)	85, 322, 516
Mva1269I	GAATGC	1 cut(s)	501
MwoI	GCNNNNNNNGC	2 cut(s)	288, 480
NdeII	GATC	4 cut(s)	115, 235, 389, 454
NlaIII	CATG	5 cut(s)	201, 348, 362, 464, 527
NspI	RCATGY	1 cut(s)	348
PaeI	GCATGC	1 cut(s)	348
PceI	AGGCCT	1 cut(s)	468
PctI	GAATGC	1 cut(s)	501
PfeI	GAWTC	1 cut(s)	536
PkrI	GCNGC	4 cut(s)	87, 290, 343, 518
PleI	GAGTC	1 cut(s)	12
PpsI	GAGTC	1 cut(s)	12
PstNI	CAGNNNCTG	1 cut(s)	288
PvuII	CAGCTG	2 cut(s)	85, 322
RsaI	GTAC	2 cut(s)	93, 528
RsaNI	GTAC	2 cut(s)	92, 527
RseI	CAYNNNNRTG	1 cut(s)	349
SaqAI	TTAA	2 cut(s)	43, 372
SatI	GCNGC	4 cut(s)	86, 289, 342, 517
Sau3AI	GATC	4 cut(s)	115, 235, 389, 454
SchI	GAGTC	1 cut(s)	12
SduI	GDGCHC	1 cut(s)	417
SetI	ASST	6 cut(s)	87, 157, 265, 290, 324, 410
SfaNI	GCATC	2 cut(s)	92, 323
SmiMI	CAYNNNNRTG	1 cut(s)	349
SphI	GCATGC	1 cut(s)	348
Sse9I	AATT	4 cut(s)	160, 268, 373, 432
SseBI	AGGCCT	1 cut(s)	468
SsiI	CCGC	1 cut(s)	514
SspMI	CTAG	2 cut(s)	229, 327
StuI	AGGCCT	1 cut(s)	468
TaiI	ACGT	1 cut(s)	157
TaqI	TCGA	3 cut(s)	118, 244, 449
TaqII	GACCGA	1 cut(s)	64
TasI	AATT	4 cut(s)	160, 268, 373, 432
TatI	WGTACW	2 cut(s)	91, 526
TfiI	GAWTC	1 cut(s)	536
Tru1I	TTAA	2 cut(s)	43, 372
Tru9I	TTAA	2 cut(s)	43, 372
TseI	GCWGC	4 cut(s)	85, 288, 341, 516
TspDTI	ATGAA	3 cut(s)	161, 449, 494
XapI	RAATTY	1 cut(s)	268
XceI	RCATGY	1 cut(s)	348
XmiI	GTMKAC	2 cut(s)	307, 401
XspI	CTAG	2 cut(s)	229, 327

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.