Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8464529.1

Orthogroup ID

OG0005006

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1792

Gene Structure 1791 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8464529.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 446 bp

atgatatgggacttgagaacaaatcaagcccaagactctgtcaaagttcatgagaaagaggtaaactatctatctttccatccgtgtaatgagtgggttttggctacagcatcttcagacactactgtgggtctgtttgatatgcggaagctgacgttaccattgcatgctctgagtggccacacagaggaggtatttcaggttgaatgggaccctaatcatgatactgtgttggcatcttatgctggtgaccgaaggttgatagtttgggaccttaacaggattggggatgagcagttggagggagatggtgatgatgggccaccagaacttctgttttcacatggcggtcataaagcaaagatttcagatttctcatggaacaaagaagttccatggctcatttcaagtgtagccgaagacaacactctccaggtctggcaaat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0031461 GO:0032991 GO:0044424 GO:0044444 GO:0044464 GO:0080008 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

ko04218 map04218

Pfam Domains

Protein Families

CAF1C_H4-bd WD40

Protein Analysis

148

Amino Acids

16.86

Weight (kDa)

4.64

Isoelectric Point (pI)

27.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005006)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G16780 AT4G35050
fragaria_vesca	FvH4_2g01180
malus_domestica	MD05G1121700.v1.1 MD10G1124300.v1.1
prunus_persica	Prupe.8G165500_v2.0.a1
pyrus_communis	pycom05g11570
rosa_chinensis	RchiOBHm_Chr6g0251791 RchiOBHm_Chr6g0251811
rosa_laevigata	RLG00000015428 RLG00000015429
rosa_multiflora	Rmu_co8247185.1_g000001 Rmu_co8464529.1_g000001 Rmu_sc0003965.1_g000001 Rmu_sc0019305.1_g000001 Rmu_sc0025272.1_g000001 Rmu_ssc0000213.1_g000115 Rmu_ssc0000213.1_g000116
rosa_roxburghii	Rroxscaffold_7G00216370 Rroxscaffold_7G00216380
rosa_rugosa	Rorug05G0504000
rosa_samantha	Rh6AG014800 Rh6AG014900 Rh6BG013200 Rh6BG013300 Rh6CG010200 Rh6CG010300 Rh6DG011400 Rh6DG011500
rosa_wichuraiana	Rw6G001470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	145, 348
AcoI	YGGCCR	1 cut(s)	178
AcuI	CTGAAG	1 cut(s)	99
AfiI	CCNNNNNNNGG	1 cut(s)	187
AgsI	TTSAA	2 cut(s)	206, 408
AjnI	CCWGG	1 cut(s)	432
AleI	CACNNNNGTG	1 cut(s)	125
AluBI	AGCT	1 cut(s)	151
AluI	AGCT	1 cut(s)	151
AoxI	GGCC	2 cut(s)	178, 320
AspS9I	GGNCC	3 cut(s)	211, 271, 320
AsuHPI	GGTGA	2 cut(s)	260, 323
AvaII	GGWCC	2 cut(s)	211, 271
BalI	TGGCCA	1 cut(s)	180
BbsI	GAAGAC	1 cut(s)	426
BccI	CCATC	3 cut(s)	87, 302, 311
BciT130I	CCWGG	1 cut(s)	434
BfmI	CTRYAG	1 cut(s)	105
Bme1390I	CCNGG	1 cut(s)	434
Bme18I	GGWCC	2 cut(s)	211, 271
BmgT120I	GGNCC	3 cut(s)	211, 271, 320
BmiI	GGNNCC	3 cut(s)	212, 213, 272
BmrFI	CCNGG	1 cut(s)	434
BmsI	GCATC	2 cut(s)	119, 245
BpiI	GAAGAC	1 cut(s)	426
BpmI	CTGGAG	1 cut(s)	416
BpuEI	CTTGAG	1 cut(s)	34
BsaJI	CCNNGG	1 cut(s)	395
Bsc4I	CCNNNNNNNGG	1 cut(s)	187
Bse3DI	GCAATG	1 cut(s)	161
BseBI	CCWGG	1 cut(s)	434
BseDI	CCNNGG	1 cut(s)	395
BseGI	GGATG	2 cut(s)	79, 295
BseLI	CCNNNNNNNGG	1 cut(s)	187
BseMI	GCAATG	1 cut(s)	161
BseMII	CTCAG	1 cut(s)	164
BseRI	GAGGAG	1 cut(s)	203
BshFI	GGCC	2 cut(s)	180, 322
BslFI	GGGAC	3 cut(s)	23, 224, 284
BslI	CCNNNNNNNGG	1 cut(s)	187
BsmFI	GGGAC	3 cut(s)	23, 224, 284
BsnI	GGCC	2 cut(s)	180, 322
Bsp19I	CCATGG	1 cut(s)	395
BspACI	CCGC	2 cut(s)	145, 348
BspANI	GGCC	2 cut(s)	180, 322
BspCNI	CTCAG	1 cut(s)	165
BspHI	TCATGA	2 cut(s)	49, 220
BspLI	GGNNCC	3 cut(s)	212, 213, 272
BsrDI	GCAATG	1 cut(s)	161
BssECI	CCNNGG	1 cut(s)	395
BssT1I	CCWWGG	1 cut(s)	395
Bst2UI	CCWGG	1 cut(s)	434
Bst4CI	ACNGT	2 cut(s)	127, 229
BstAPI	GCANNNNNTGC	1 cut(s)	242
BstC8I	GCNNGC	1 cut(s)	168
BstDEI	CTNAG	1 cut(s)	173
BstDSI	CCRYGG	1 cut(s)	395
BstEII	GGTNACC	1 cut(s)	248
BstF5I	GGATG	2 cut(s)	79, 295
BstMWI	GCNNNNNNNGC	1 cut(s)	242
BstNI	CCWGG	1 cut(s)	434
BstNSI	RCATGY	1 cut(s)	170
BstPI	GGTNACC	1 cut(s)	248
BstSCI	CCNGG	1 cut(s)	432
BstSFI	CTRYAG	1 cut(s)	105
BstV2I	GAAGAC	1 cut(s)	426
BsuRI	GGCC	2 cut(s)	180, 322
BtgI	CCRYGG	1 cut(s)	395
BtsCI	GGATG	2 cut(s)	79, 295
Cac8I	GCNNGC	1 cut(s)	168
CciI	TCATGA	2 cut(s)	49, 220
Cfr13I	GGNCC	3 cut(s)	211, 271, 320
CviAII	CATG	6 cut(s)	50, 167, 221, 344, 378, 396
CviJI	RGCY	7 cut(s)	29, 104, 151, 180, 322, 400, 416
CviKI_1	RGCY	7 cut(s)	29, 104, 151, 180, 322, 400, 416
DdeI	CTNAG	1 cut(s)	173
EaeI	YGGCCR	1 cut(s)	178
Eco130I	CCWWGG	1 cut(s)	395
Eco47I	GGWCC	2 cut(s)	211, 271
Eco57I	CTGAAG	1 cut(s)	99
Eco91I	GGTNACC	1 cut(s)	248
EcoO109I	RGGNCCY	2 cut(s)	211, 271
EcoO65I	GGTNACC	1 cut(s)	248
EcoRII	CCWGG	1 cut(s)	432
EcoT14I	CCWWGG	1 cut(s)	395
ErhI	CCWWGG	1 cut(s)	395
FaeI	CATG	6 cut(s)	53, 170, 224, 347, 381, 399
FaqI	GGGAC	3 cut(s)	23, 224, 284
FatI	CATG	6 cut(s)	49, 166, 220, 343, 377, 395
FokI	GGATG	2 cut(s)	66, 302
GsuI	CTGGAG	1 cut(s)	416
HaeIII	GGCC	2 cut(s)	180, 322
Hin1II	CATG	6 cut(s)	53, 170, 224, 347, 381, 399
HinfI	GANTC	1 cut(s)	35
HphI	GGTGA	2 cut(s)	260, 323
Hpy166II	GTNNAC	1 cut(s)	64
Hpy188I	TCNGA	3 cut(s)	118, 174, 370
Hpy188III	TCNNGA	2 cut(s)	50, 221
Hpy8I	GTNNAC	1 cut(s)	64
HpyAV	CCTTC	1 cut(s)	249
HpyCH4III	ACNGT	2 cut(s)	127, 229
HpyCH4IV	ACGT	1 cut(s)	155
HpyCH4V	TGCA	1 cut(s)	166
HpyF10VI	GCNNNNNNNGC	1 cut(s)	242
HpyF3I	CTNAG	1 cut(s)	173
HpySE526I	ACGT	1 cut(s)	155
Hsp92II	CATG	6 cut(s)	53, 170, 224, 347, 381, 399
KflI	GGGWCCC	1 cut(s)	211
LpnPI	CCDG	6 cut(s)	185, 231, 265, 339, 419, 424
LweI	GCATC	2 cut(s)	119, 245
MaeII	ACGT	1 cut(s)	155
MaeIII	GTNAC	2 cut(s)	156, 248
MboII	GAAGA	2 cut(s)	105, 431
MlsI	TGGCCA	1 cut(s)	180
MluNI	TGGCCA	1 cut(s)	180
MlyI	GAGTC	1 cut(s)	29
MmeI	TCCRAC	1 cut(s)	279
MnlI	CCTC	4 cut(s)	52, 181, 184, 295
Mox20I	TGGCCA	1 cut(s)	180
MscI	TGGCCA	1 cut(s)	180
MseI	TTAA	1 cut(s)	276
MslI	CAYNNNNRTG	1 cut(s)	125
Msp20I	TGGCCA	1 cut(s)	180
MspR9I	CCNGG	1 cut(s)	434
MvaI	CCWGG	1 cut(s)	434
MwoI	GCNNNNNNNGC	1 cut(s)	242
NcoI	CCATGG	1 cut(s)	395
NlaIII	CATG	6 cut(s)	53, 170, 224, 347, 381, 399
NlaIV	GGNNCC	3 cut(s)	212, 213, 272
NmuCI	GTSAC	1 cut(s)	248
NspI	RCATGY	1 cut(s)	170
OliI	CACNNNNGTG	1 cut(s)	125
PaeI	GCATGC	1 cut(s)	170
PagI	TCATGA	2 cut(s)	49, 220
PflFI	GACNNNGTC	1 cut(s)	38
PleI	GAGTC	1 cut(s)	29
PpsI	GAGTC	1 cut(s)	29
PpuMI	RGGWCCY	2 cut(s)	211, 271
Psp5II	RGGWCCY	2 cut(s)	211, 271
Psp6I	CCWGG	1 cut(s)	432
PspEI	GGTNACC	1 cut(s)	248
PspGI	CCWGG	1 cut(s)	432
PspN4I	GGNNCC	3 cut(s)	212, 213, 272
PspPI	GGNCC	3 cut(s)	211, 271, 320
PspPPI	RGGWCCY	2 cut(s)	211, 271
PsyI	GACNNNGTC	1 cut(s)	38
RseI	CAYNNNNRTG	1 cut(s)	125
SaqAI	TTAA	1 cut(s)	276
Sau96I	GGNCC	3 cut(s)	211, 271, 320
SchI	GAGTC	1 cut(s)	29
ScrFI	CCNGG	1 cut(s)	434
SetI	ASST	8 cut(s)	63, 153, 158, 195, 204, 260, 276, 438
SfaNI	GCATC	2 cut(s)	119, 245
SfcI	CTRYAG	1 cut(s)	105
SinI	GGWCC	2 cut(s)	211, 271
SmiMI	CAYNNNNRTG	1 cut(s)	125
SmlI	CTYRAG	1 cut(s)	13
SmoI	CTYRAG	1 cut(s)	13
SphI	GCATGC	1 cut(s)	170
SsiI	CCGC	2 cut(s)	145, 348
StyD4I	CCNGG	1 cut(s)	432
StyI	CCWWGG	1 cut(s)	395
TaaI	ACNGT	2 cut(s)	127, 229
TaiI	ACGT	1 cut(s)	158
TaqII	GACCGA	1 cut(s)	267
Tru1I	TTAA	1 cut(s)	276
Tru9I	TTAA	1 cut(s)	276
TseFI	GTSAC	1 cut(s)	248
Tsp45I	GTSAC	1 cut(s)	248
TspDTI	ATGAA	1 cut(s)	38
TspGWI	ACGGA	1 cut(s)	72
Tth111I	GACNNNGTC	1 cut(s)	38
VpaK11BI	GGWCC	2 cut(s)	211, 271
XceI	RCATGY	1 cut(s)	170

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.