Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000213.1

Orthogroup ID

OG0005006

Physical Location & Seq

Genomic Coordinates Forward (+)

459265 .. 459919

Gene Structure 655 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000213.1_g000116.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 414 bp

atggttgtaggcaagtttagatcccttgtttcaagtgagcagttaagaattacagcttgtcagccccctataagatatttcatttgggaagtaaacattcctgaaaatcgaagaaaggaggtattccaggttgaatgggaccctaatcatgatactgtgctggcatcttacgctggaggaagatggctggagggtgatggggatgagcagttggagggtgatggggatgatgggccaccagacctgttttcacatggcggtcatagggcaaagatatcacatttctcatggaacaaagaagttccatggctcatttcaagtgtagccgaagacaacactctccaggtctggcaaatggctgatggcatttacggtgacgatgatgtgcaagaaggggaatcttctgatatctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0031461 GO:0032991 GO:0044424 GO:0044444 GO:0044464 GO:0080008 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

ko04218 map04218

Pfam Domains

Protein Families

CAF1C_H4-bd WD40

Protein Analysis

137

Amino Acids

15.52

Weight (kDa)

4.38

Isoelectric Point (pI)

48.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005006)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G16780 AT4G35050
fragaria_vesca	FvH4_2g01180
malus_domestica	MD05G1121700.v1.1 MD10G1124300.v1.1
prunus_persica	Prupe.8G165500_v2.0.a1
pyrus_communis	pycom05g11570
rosa_chinensis	RchiOBHm_Chr6g0251791 RchiOBHm_Chr6g0251811
rosa_laevigata	RLG00000015428 RLG00000015429
rosa_multiflora	Rmu_co8247185.1_g000001 Rmu_co8464529.1_g000001 Rmu_sc0003965.1_g000001 Rmu_sc0019305.1_g000001 Rmu_sc0025272.1_g000001 Rmu_ssc0000213.1_g000115 Rmu_ssc0000213.1_g000116
rosa_roxburghii	Rroxscaffold_7G00216370 Rroxscaffold_7G00216380
rosa_rugosa	Rorug05G0504000
rosa_samantha	Rh6AG014800 Rh6AG014900 Rh6BG013200 Rh6BG013300 Rh6CG010200 Rh6CG010300 Rh6DG011400 Rh6DG011500
rosa_wichuraiana	Rw6G001470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	258
AclWI	GGATC	1 cut(s)	15
AgsI	TTSAA	3 cut(s)	33, 134, 318
AjnI	CCWGG	2 cut(s)	126, 342
AluBI	AGCT	1 cut(s)	56
AluI	AGCT	1 cut(s)	56
AlwI	GGATC	1 cut(s)	15
AoxI	GGCC	1 cut(s)	233
AspS9I	GGNCC	2 cut(s)	139, 233
AsuHPI	GGTGA	3 cut(s)	206, 230, 386
AvaII	GGWCC	1 cut(s)	139
BbsI	GAAGAC	1 cut(s)	336
BccI	CCATC	5 cut(s)	177, 191, 215, 224, 356
BciT130I	CCWGG	2 cut(s)	128, 344
Bme1390I	CCNGG	2 cut(s)	128, 344
Bme18I	GGWCC	1 cut(s)	139
BmgT120I	GGNCC	2 cut(s)	139, 233
BmiI	GGNNCC	2 cut(s)	140, 141
BmrFI	CCNGG	2 cut(s)	128, 344
BmsI	GCATC	1 cut(s)	173
BpiI	GAAGAC	1 cut(s)	336
BpmI	CTGGAG	3 cut(s)	195, 209, 326
BsaJI	CCNNGG	1 cut(s)	305
BseBI	CCWGG	2 cut(s)	128, 344
BseDI	CCNNGG	1 cut(s)	305
BseGI	GGATG	2 cut(s)	208, 232
BshFI	GGCC	1 cut(s)	235
BslFI	GGGAC	1 cut(s)	152
BsmFI	GGGAC	1 cut(s)	152
BsnI	GGCC	1 cut(s)	235
Bsp143I	GATC	1 cut(s)	20
Bsp19I	CCATGG	1 cut(s)	305
BspACI	CCGC	1 cut(s)	258
BspANI	GGCC	1 cut(s)	235
BspHI	TCATGA	1 cut(s)	148
BspLI	GGNNCC	2 cut(s)	140, 141
BspPI	GGATC	1 cut(s)	15
BssECI	CCNNGG	1 cut(s)	305
BssMI	GATC	1 cut(s)	20
BssT1I	CCWWGG	1 cut(s)	305
Bst2UI	CCWGG	2 cut(s)	128, 344
Bst4CI	ACNGT	2 cut(s)	157, 374
BstC8I	GCNNGC	1 cut(s)	162
BstDSI	CCRYGG	1 cut(s)	305
BstF5I	GGATG	2 cut(s)	208, 232
BstKTI	GATC	1 cut(s)	23
BstMBI	GATC	1 cut(s)	20
BstMWI	GCNNNNNNNGC	1 cut(s)	170
BstNI	CCWGG	2 cut(s)	128, 344
BstSCI	CCNGG	2 cut(s)	126, 342
BstV2I	GAAGAC	1 cut(s)	336
BstX2I	RGATCY	1 cut(s)	20
BstYI	RGATCY	1 cut(s)	20
BsuRI	GGCC	1 cut(s)	235
BtgI	CCRYGG	1 cut(s)	305
BtsCI	GGATG	2 cut(s)	208, 232
Cac8I	GCNNGC	1 cut(s)	162
CciI	TCATGA	1 cut(s)	148
Cfr13I	GGNCC	2 cut(s)	139, 233
CviAII	CATG	4 cut(s)	149, 254, 288, 306
CviJI	RGCY	7 cut(s)	56, 64, 187, 235, 310, 326, 359
CviKI_1	RGCY	7 cut(s)	56, 64, 187, 235, 310, 326, 359
DpnI	GATC	1 cut(s)	22
DpnII	GATC	1 cut(s)	20
Eco130I	CCWWGG	1 cut(s)	305
Eco32I	GATATC	2 cut(s)	276, 409
Eco47I	GGWCC	1 cut(s)	139
EcoO109I	RGGNCCY	1 cut(s)	139
EcoRII	CCWGG	2 cut(s)	126, 342
EcoRV	GATATC	2 cut(s)	276, 409
EcoT14I	CCWWGG	1 cut(s)	305
ErhI	CCWWGG	1 cut(s)	305
FaeI	CATG	4 cut(s)	152, 257, 291, 309
FaiI	YATR	6 cut(s)	71, 150, 255, 264, 289, 307
FaqI	GGGAC	1 cut(s)	152
FatI	CATG	4 cut(s)	148, 253, 287, 305
FokI	GGATG	2 cut(s)	215, 239
GsuI	CTGGAG	3 cut(s)	195, 209, 326
HaeIII	GGCC	1 cut(s)	235
Hin1II	CATG	4 cut(s)	152, 257, 291, 309
HinfI	GANTC	1 cut(s)	398
HphI	GGTGA	3 cut(s)	206, 230, 386
Hpy166II	GTNNAC	1 cut(s)	94
Hpy188I	TCNGA	2 cut(s)	406, 413
Hpy188III	TCNNGA	2 cut(s)	101, 149
Hpy8I	GTNNAC	1 cut(s)	94
HpyAV	CCTTC	1 cut(s)	386
HpyCH4III	ACNGT	2 cut(s)	157, 374
HpyCH4V	TGCA	1 cut(s)	388
HpyF10VI	GCNNNNNNNGC	1 cut(s)	170
Hsp92II	CATG	4 cut(s)	152, 257, 291, 309
KflI	GGGWCCC	1 cut(s)	139
Kzo9I	GATC	1 cut(s)	20
LweI	GCATC	1 cut(s)	173
MaeIII	GTNAC	1 cut(s)	374
MalI	GATC	1 cut(s)	22
MboI	GATC	1 cut(s)	20
MboII	GAAGA	4 cut(s)	123, 192, 341, 393
MflI	RGATCY	1 cut(s)	20
MluCI	AATT	1 cut(s)	48
MmeI	TCCRAC	1 cut(s)	192
MnlI	CCTC	4 cut(s)	112, 170, 184, 208
MseI	TTAA	1 cut(s)	44
MspR9I	CCNGG	2 cut(s)	128, 344
MvaI	CCWGG	2 cut(s)	128, 344
MwoI	GCNNNNNNNGC	1 cut(s)	170
NcoI	CCATGG	1 cut(s)	305
NdeII	GATC	1 cut(s)	20
NlaIII	CATG	4 cut(s)	152, 257, 291, 309
NlaIV	GGNNCC	2 cut(s)	140, 141
NmuCI	GTSAC	1 cut(s)	374
PagI	TCATGA	1 cut(s)	148
PfeI	GAWTC	1 cut(s)	398
PpuMI	RGGWCCY	1 cut(s)	139
Psp5II	RGGWCCY	1 cut(s)	139
Psp6I	CCWGG	2 cut(s)	126, 342
PspGI	CCWGG	2 cut(s)	126, 342
PspN4I	GGNNCC	2 cut(s)	140, 141
PspPI	GGNCC	2 cut(s)	139, 233
PspPPI	RGGWCCY	1 cut(s)	139
PsuI	RGATCY	1 cut(s)	20
SaqAI	TTAA	1 cut(s)	44
Sau3AI	GATC	1 cut(s)	20
Sau96I	GGNCC	2 cut(s)	139, 233
ScrFI	CCNGG	2 cut(s)	128, 344
SetI	ASST	5 cut(s)	58, 123, 132, 246, 348
SfaNI	GCATC	1 cut(s)	173
SinI	GGWCC	1 cut(s)	139
Sse9I	AATT	1 cut(s)	48
SsiI	CCGC	1 cut(s)	258
StyD4I	CCNGG	2 cut(s)	126, 342
StyI	CCWWGG	1 cut(s)	305
TaaI	ACNGT	2 cut(s)	157, 374
TaqI	TCGA	1 cut(s)	109
TasI	AATT	1 cut(s)	48
TfiI	GAWTC	1 cut(s)	398
Tru1I	TTAA	1 cut(s)	44
Tru9I	TTAA	1 cut(s)	44
TseFI	GTSAC	1 cut(s)	374
Tsp45I	GTSAC	1 cut(s)	374
TspDTI	ATGAA	1 cut(s)	70
VpaK11BI	GGWCC	1 cut(s)	139

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.