Rmu_sc0000054.1_g000006

Upstream in-frame stop codon

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000054.1
Physical Location & Seq
Forward (+)
24431 .. 25221
791 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000054.1_g000006.1.cds

Sequence Viewer

Length: 348 bp
atgagttaccacaatgttgttcatgttggtcaccaatctcatgatccatcagggtatccatcggaatatcctccaccgcctaattttcttccaccgcagcagccggggtttccgaaccctcatgagtttcatggccctcctccgcctcagccaccgcatcaacaccatcaacgctatcaggattacttctatgaaggctacccgccgccgcattcagctcagccctacaatcgccaacattaccagaacaacccatatgactatgacagtggctgccctcctttcctcaattcctgtttggccgcactctgctgctgctgccttttggagcgctgctgcttgtggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

13.31

Weight (kDa)

6.06

Isoelectric Point (pI)

83.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 8 cut(s) 77, 95, 143, 155, 203, 206, 209, 303
AclWI GGATC 1 cut(s) 38
AcoI YGGCCR 1 cut(s) 300
AfeI AGCGCT 1 cut(s) 332
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
AlwI GGATC 1 cut(s) 38
AlwNI CAGNNNCTG 1 cut(s) 273
Aor51HI AGCGCT 1 cut(s) 332
AoxI GGCC 2 cut(s) 133, 300
ApeKI GCWGC 8 cut(s) 97, 100, 273, 312, 315, 318, 333, 336
AspLEI GCGC 1 cut(s) 333
AspS9I GGNCC 1 cut(s) 134
AsuC2I CCSGG 1 cut(s) 105
AsuHPI GGTGA 1 cut(s) 23
BbvCI CCTCAGC 1 cut(s) 147
BbvI GCAGC 8 cut(s) 109, 112, 260, 299, 302, 305, 320, 323
BccI CCATC 3 cut(s) 55, 67, 174
BciVI GTATCC 1 cut(s) 66
BcnI CCSGG 1 cut(s) 105
BfoI RGCGCY 1 cut(s) 334
BfuI GTATCC 1 cut(s) 66
BlpI GCTNAGC 1 cut(s) 219
Bme1390I CCNGG 1 cut(s) 105
BmgT120I GGNCC 1 cut(s) 134
BmrFI CCNGG 1 cut(s) 105
BmsI GCATC 1 cut(s) 166
Bpu10I CCTNAGC 1 cut(s) 147
Bpu1102I GCTNAGC 1 cut(s) 219
BpuMI CCSGG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 104
BseDI CCNNGG 1 cut(s) 104
BseMII CTCAG 2 cut(s) 161, 233
BseRI GAGGAG 1 cut(s) 129
BseXI GCAGC 8 cut(s) 109, 112, 260, 299, 302, 305, 320, 323
BshFI GGCC 2 cut(s) 135, 302
BsiSI CCGG 1 cut(s) 104
BsmI GAATGC 1 cut(s) 211
BsnI GGCC 2 cut(s) 135, 302
Bsp143I GATC 1 cut(s) 43
Bsp1720I GCTNAGC 1 cut(s) 219
BspACI CCGC 8 cut(s) 77, 95, 143, 155, 203, 206, 209, 303
BspANI GGCC 2 cut(s) 135, 302
BspCNI CTCAG 2 cut(s) 160, 232
BspHI TCATGA 2 cut(s) 40, 121
BspPI GGATC 1 cut(s) 38
BssECI CCNNGG 1 cut(s) 104
BssMI GATC 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 269
BstDEI CTNAG 2 cut(s) 147, 219
BstEII GGTNACC 1 cut(s) 29
BstH2I RGCGCY 1 cut(s) 334
BstHHI GCGC 1 cut(s) 333
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstMWI GCNNNNNNNGC 1 cut(s) 318
BstPI GGTNACC 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 103
BstV1I GCAGC 8 cut(s) 109, 112, 260, 299, 302, 305, 320, 323
BsuI GTATCC 1 cut(s) 66
BsuRI GGCC 2 cut(s) 135, 302
BtsIMutI CAGTG 1 cut(s) 274
CaiI CAGNNNCTG 1 cut(s) 273
CciI TCATGA 2 cut(s) 40, 121
CfoI GCGC 1 cut(s) 333
Cfr13I GGNCC 1 cut(s) 134
CviAII CATG 4 cut(s) 23, 41, 122, 131
CviJI RGCY 8 cut(s) 103, 135, 151, 198, 218, 223, 273, 302
CviKI_1 RGCY 8 cut(s) 103, 135, 151, 198, 218, 223, 273, 302
DdeI CTNAG 2 cut(s) 147, 219
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
EaeI YGGCCR 1 cut(s) 300
EciI GGCGGA 1 cut(s) 132
Eco47III AGCGCT 1 cut(s) 332
Eco91I GGTNACC 1 cut(s) 29
EcoO65I GGTNACC 1 cut(s) 29
FaeI CATG 4 cut(s) 26, 44, 125, 134
FaiI YATR 8 cut(s) 24, 42, 123, 132, 192, 256, 258, 264
FatI CATG 4 cut(s) 22, 40, 121, 130
FauI CCCGC 1 cut(s) 210
FauNDI CATATG 1 cut(s) 256
GlaI GCGC 1 cut(s) 332
HaeII RGCGCY 1 cut(s) 334
HaeIII GGCC 2 cut(s) 135, 302
HapII CCGG 1 cut(s) 104
HhaI GCGC 1 cut(s) 333
Hin1II CATG 4 cut(s) 26, 44, 125, 134
Hin6I GCGC 1 cut(s) 331
HinP1I GCGC 1 cut(s) 331
HpaII CCGG 1 cut(s) 104
HphI GGTGA 1 cut(s) 23
Hpy188I TCNGA 2 cut(s) 64, 114
Hpy188III TCNNGA 3 cut(s) 41, 122, 179
HpyAV CCTTC 1 cut(s) 188
HpyCH4III ACNGT 1 cut(s) 269
HpyF10VI GCNNNNNNNGC 1 cut(s) 318
HpyF3I CTNAG 2 cut(s) 147, 219
Hsp92II CATG 4 cut(s) 26, 44, 125, 134
HspAI GCGC 1 cut(s) 331
Kzo9I GATC 1 cut(s) 43
LmnI GCTCC 1 cut(s) 328
LpnPI CCDG 5 cut(s) 36, 117, 164, 257, 307
Lsp1109I GCAGC 8 cut(s) 109, 112, 260, 299, 302, 305, 320, 323
LweI GCATC 1 cut(s) 166
MaeIII GTNAC 2 cut(s) 5, 29
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 1 cut(s) 80
MluCI AATT 2 cut(s) 82, 289
MnlI CCTC 7 cut(s) 81, 129, 147, 150, 156, 288, 296
MspI CCGG 1 cut(s) 104
MspR9I CCNGG 1 cut(s) 105
Mva1269I GAATGC 1 cut(s) 211
MwoI GCNNNNNNNGC 1 cut(s) 318
NciI CCSGG 1 cut(s) 105
NdeI CATATG 1 cut(s) 256
NdeII GATC 1 cut(s) 43
NlaIII CATG 4 cut(s) 26, 44, 125, 134
NmuCI GTSAC 1 cut(s) 29
PagI TCATGA 2 cut(s) 40, 121
PctI GAATGC 1 cut(s) 211
PspEI GGTNACC 1 cut(s) 29
PspPI GGNCC 1 cut(s) 134
PstNI CAGNNNCTG 1 cut(s) 273
Sau3AI GATC 1 cut(s) 43
Sau96I GGNCC 1 cut(s) 134
ScrFI CCNGG 1 cut(s) 105
SetI ASST 1 cut(s) 220
SfaNI GCATC 1 cut(s) 166
Sse9I AATT 2 cut(s) 82, 289
SsiI CCGC 8 cut(s) 77, 95, 143, 155, 203, 206, 209, 303
StyD4I CCNGG 1 cut(s) 103
TaaI ACNGT 1 cut(s) 269
TasI AATT 2 cut(s) 82, 289
TauI GCSGC 3 cut(s) 208, 211, 305
TscAI CASTG 1 cut(s) 274
TseFI GTSAC 1 cut(s) 29
TseI GCWGC 8 cut(s) 97, 100, 273, 312, 315, 318, 333, 336
Tsp45I GTSAC 1 cut(s) 29
TspDTI ATGAA 3 cut(s) 11, 119, 207
TspRI CASTG 1 cut(s) 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.