Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000352.1

Orthogroup ID

OG0005868

Physical Location & Seq

Genomic Coordinates Forward (+)

35105 .. 36766

Gene Structure 1662 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000352.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 624 bp

atgagtgccgtcaacatcacaaacgtcgccgttttggacaacccctccgcttttctcaacccgttccagttcgaaatctcatacgagtgcttggcttccctcaaagacgacttggaatggaagctcatatatgtcggatctgctgaagatgagacgtatgaccaacttttggagagtgtgcttgttggtcctgtcaatgttggcaactaccgttttgtatttcaggctgaccctccagacccatcaaaaatacgtgatgaagatatcattggtgtcacagtactgctgttgacatgttcatatatggggcaggagtttgttagggtgggatactatgtgaacaatgattatgatgatgaacaactgagagaggaacctccccctaagttgctgattgatagggtccagagaaacattttagctgacaagccgcgagtcacaaaattcccaataaattttcatcctgagaacaatgaacacgaggagccacccccttcttcacttgatgacgcaacagaaccaaagcaacccctatcttcgcctgatttagcaactgagttgaacatcactgcagaagaaccatcccttccacctgtatcatctgtcggaagtgcggaaaattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000075 GO:0000278 GO:0000724 GO:0000725 GO:0000902 GO:0000904 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0006139 GO:0006259 GO:0006281 GO:0006302 GO:0006310 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0007049 GO:0007093 GO:0007346 GO:0008150 GO:0008152 GO:0008361 GO:0009292 GO:0009294 GO:0009653 GO:0009888 GO:0009987 GO:0010026 GO:0010090 GO:0010091 GO:0016043 GO:0022402 GO:0030154 GO:0031567 GO:0032502 GO:0032535 GO:0032989 GO:0033554 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044260 GO:0044424 GO:0044464 GO:0044764 GO:0045786 GO:0045930 GO:0046483 GO:0048468 GO:0048519 GO:0048523 GO:0048856 GO:0048869 GO:0050789 GO:0050794 GO:0050896 GO:0051301 GO:0051704 GO:0051716 GO:0051726 GO:0065007 GO:0065008 GO:0071704 GO:0071840 GO:0090066 GO:0090304 GO:0090558 GO:0090626 GO:1901360 GO:1903047

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ASF1_hist_chap

Protein Analysis

207

Amino Acids

23.17

Weight (kDa)

4.15

Isoelectric Point (pI)

53.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005868)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G66740 AT5G38110
fragaria_vesca	FvH4_4g26330
malus_domestica	MD00G1054200.v1.1 MD09G1258300.v1.1 MD13G1031600.v1.1 MD16G1033700.v1.1
prunus_persica	Prupe.1G320600_v2.0.a1 Prupe.3G150200_v2.0.a1
pyrus_communis	pycom09g17320 pycom13g02760 pycom16g02830 pycom17g25530
rosa_chinensis	RchiOBHm_Chr4g0433911
rosa_laevigata	RLG00000006718
rosa_multiflora	Rmu_sc0000352.1_g000012
rosa_roxburghii	Rroxscaffold_4G00307590 Rroxscaffold_5G00375330
rosa_rugosa	Rorug04G0272200
rosa_samantha	Rh4AG327200 Rh4BG334500 Rh4CG350300 Rh4DG331400 Rh5BG464100 Rh5CG486100 Rh5DG478100
rosa_wichuraiana	Rw2G041650 Rw4G028360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	169
AccII	CGCG	1 cut(s)	433
AciI	CCGC	3 cut(s)	48, 431, 614
AclWI	GGATC	1 cut(s)	145
AcsI	RAATTY	2 cut(s)	443, 454
AcuI	CTGAAG	1 cut(s)	165
AfaI	GTAC	1 cut(s)	282
AfiI	CCNNNNNNNGG	1 cut(s)	169
AflIII	ACRYGT	1 cut(s)	293
AgsI	TTSAA	1 cut(s)	562
AjuI	GAANNNNNNNTTGG	2 cut(s)	252, 284
AluBI	AGCT	2 cut(s)	124, 422
AluI	AGCT	2 cut(s)	124, 422
Alw26I	GTCTC	1 cut(s)	146
AlwI	GGATC	1 cut(s)	145
ApoI	RAATTY	2 cut(s)	443, 454
AspS9I	GGNCC	2 cut(s)	188, 403
AsuII	TTCGAA	1 cut(s)	72
AvaII	GGWCC	2 cut(s)	188, 403
BauI	CACGAG	1 cut(s)	479
BccI	CCATC	2 cut(s)	250, 589
BceAI	ACGGC	1 cut(s)	14
BciVI	GTATCC	1 cut(s)	323
BcoDI	GTCTC	1 cut(s)	146
BfmI	CTRYAG	1 cut(s)	570
BfuI	GTATCC	1 cut(s)	323
BisI	GCNGC	1 cut(s)	431
BlsI	GCNGC	1 cut(s)	432
BmcAI	AGTACT	1 cut(s)	282
Bme18I	GGWCC	2 cut(s)	188, 403
BmgT120I	GGNCC	2 cut(s)	188, 403
BmiI	GGNNCC	3 cut(s)	375, 404, 486
BpmI	CTGGAG	1 cut(s)	219
Bpu14I	TTCGAA	1 cut(s)	72
BsaAI	YACGTR	1 cut(s)	254
BsaXI	ACNNNNNCTCC	2 cut(s)	29, 59
Bsc4I	CCNNNNNNNGG	1 cut(s)	169
Bse1I	ACTGG	1 cut(s)	67
BseGI	GGATG	2 cut(s)	460, 581
BseLI	CCNNNNNNNGG	1 cut(s)	169
BseMII	CTCAG	3 cut(s)	356, 456, 546
BseNI	ACTGG	1 cut(s)	67
BseRI	GAGGAG	1 cut(s)	497
Bsh1236I	CGCG	1 cut(s)	433
BslI	CCNNNNNNNGG	1 cut(s)	169
BsmAI	GTCTC	1 cut(s)	146
BsmBI	CGTCTC	1 cut(s)	146
Bsp119I	TTCGAA	1 cut(s)	72
Bsp143I	GATC	1 cut(s)	137
BspACI	CCGC	3 cut(s)	48, 431, 614
BspCNI	CTCAG	3 cut(s)	357, 457, 547
BspFNI	CGCG	1 cut(s)	433
BspLI	GGNNCC	3 cut(s)	375, 404, 486
BspMAI	CTGCAG	1 cut(s)	574
BspPI	GGATC	1 cut(s)	145
BspT104I	TTCGAA	1 cut(s)	72
BsrI	ACTGG	1 cut(s)	67
BssMI	GATC	1 cut(s)	137
BssSI	CACGAG	1 cut(s)	479
Bst2BI	CACGAG	1 cut(s)	479
Bst4CI	ACNGT	2 cut(s)	212, 280
BstBAI	YACGTR	1 cut(s)	254
BstBI	TTCGAA	1 cut(s)	72
BstDEI	CTNAG	4 cut(s)	365, 384, 465, 555
BstF5I	GGATG	2 cut(s)	460, 581
BstFNI	CGCG	1 cut(s)	433
BstKTI	GATC	1 cut(s)	140
BstMAI	GTCTC	1 cut(s)	146
BstMBI	GATC	1 cut(s)	137
BstNSI	RCATGY	1 cut(s)	297
BstSFI	CTRYAG	1 cut(s)	570
BstUI	CGCG	1 cut(s)	433
BstX2I	RGATCY	1 cut(s)	137
BstYI	RGATCY	1 cut(s)	137
BsuI	GTATCC	1 cut(s)	323
BtsCI	GGATG	2 cut(s)	460, 581
BtsI	GCAGTG	1 cut(s)	567
BtsIMutI	CAGTG	1 cut(s)	567
Cfr13I	GGNCC	2 cut(s)	188, 403
CseI	GACGC	1 cut(s)	518
Csp6I	GTAC	1 cut(s)	281
CviAII	CATG	1 cut(s)	294
CviJI	RGCY	6 cut(s)	95, 124, 227, 422, 430, 487
CviKI_1	RGCY	6 cut(s)	95, 124, 227, 422, 430, 487
CviQI	GTAC	1 cut(s)	281
DdeI	CTNAG	4 cut(s)	365, 384, 465, 555
DpnI	GATC	1 cut(s)	139
DpnII	GATC	1 cut(s)	137
Eco32I	GATATC	1 cut(s)	265
Eco47I	GGWCC	2 cut(s)	188, 403
Eco57I	CTGAAG	1 cut(s)	165
EcoRV	GATATC	1 cut(s)	265
Esp3I	CGTCTC	1 cut(s)	146
FaeI	CATG	1 cut(s)	297
FatI	CATG	1 cut(s)	293
Fnu4HI	GCNGC	1 cut(s)	431
FokI	GGATG	2 cut(s)	447, 568
Fsp4HI	GCNGC	1 cut(s)	431
GluI	GCNGC	1 cut(s)	431
GsuI	CTGGAG	1 cut(s)	219
HgaI	GACGC	1 cut(s)	518
Hin1II	CATG	1 cut(s)	297
HincII	GTYRAC	2 cut(s)	13, 291
HindII	GTYRAC	2 cut(s)	13, 291
HinfI	GANTC	1 cut(s)	435
Hpy166II	GTNNAC	3 cut(s)	13, 291, 340
Hpy188I	TCNGA	2 cut(s)	137, 608
Hpy188III	TCNNGA	3 cut(s)	236, 406, 464
Hpy8I	GTNNAC	3 cut(s)	13, 291, 340
Hpy99I	CGWCG	1 cut(s)	29
HpyAV	CCTTC	2 cut(s)	504, 596
HpyCH4III	ACNGT	2 cut(s)	212, 280
HpyCH4IV	ACGT	3 cut(s)	24, 155, 253
HpyCH4V	TGCA	1 cut(s)	572
HpyF3I	CTNAG	4 cut(s)	365, 384, 465, 555
HpySE526I	ACGT	3 cut(s)	24, 155, 253
Hsp92II	CATG	1 cut(s)	297
Kzo9I	GATC	1 cut(s)	137
LmnI	GCTCC	1 cut(s)	484
LpnPI	CCDG	9 cut(s)	80, 204, 209, 249, 296, 419, 477, 555, 606
MaeII	ACGT	3 cut(s)	24, 155, 253
MaeIII	GTNAC	2 cut(s)	274, 436
MalI	GATC	1 cut(s)	139
MboI	GATC	1 cut(s)	137
MboII	GAAGA	5 cut(s)	158, 272, 489, 528, 587
MflI	RGATCY	1 cut(s)	137
MluCI	AATT	3 cut(s)	443, 454, 619
MlyI	GAGTC	1 cut(s)	444
MmeI	TCCRAC	2 cut(s)	115, 586
MnlI	CCTC	6 cut(s)	55, 110, 243, 364, 387, 475
MseI	TTAA	1 cut(s)	622
MslI	CAYNNNNRTG	1 cut(s)	85
MvnI	CGCG	1 cut(s)	433
NdeII	GATC	1 cut(s)	137
NlaIII	CATG	1 cut(s)	297
NlaIV	GGNNCC	3 cut(s)	375, 404, 486
NmuCI	GTSAC	2 cut(s)	274, 436
NspI	RCATGY	1 cut(s)	297
NspV	TTCGAA	1 cut(s)	72
PciI	ACATGT	1 cut(s)	293
PflMI	CCANNNNNTGG	1 cut(s)	169
PkrI	GCNGC	1 cut(s)	432
PleI	GAGTC	1 cut(s)	443
PpsI	GAGTC	1 cut(s)	443
Ppu21I	YACGTR	1 cut(s)	254
PscI	ACATGT	1 cut(s)	293
PspN4I	GGNNCC	3 cut(s)	375, 404, 486
PspPI	GGNCC	2 cut(s)	188, 403
PstI	CTGCAG	1 cut(s)	574
PsuI	RGATCY	1 cut(s)	137
RsaI	GTAC	1 cut(s)	282
RsaNI	GTAC	1 cut(s)	281
RseI	CAYNNNNRTG	1 cut(s)	85
SaqAI	TTAA	1 cut(s)	622
SatI	GCNGC	1 cut(s)	431
Sau3AI	GATC	1 cut(s)	137
Sau96I	GGNCC	2 cut(s)	188, 403
ScaI	AGTACT	1 cut(s)	282
SchI	GAGTC	1 cut(s)	444
SetI	ASST	7 cut(s)	27, 126, 158, 256, 379, 424, 595
SfcI	CTRYAG	1 cut(s)	570
SfuI	TTCGAA	1 cut(s)	72
SinI	GGWCC	2 cut(s)	188, 403
SmiMI	CAYNNNNRTG	1 cut(s)	85
Sse9I	AATT	3 cut(s)	443, 454, 619
SsiI	CCGC	3 cut(s)	48, 431, 614
TaaI	ACNGT	2 cut(s)	212, 280
TaiI	ACGT	3 cut(s)	27, 158, 256
TaqI	TCGA	1 cut(s)	72
TasI	AATT	3 cut(s)	443, 454, 619
TatI	WGTACW	1 cut(s)	280
TauI	GCSGC	1 cut(s)	433
Tru1I	TTAA	1 cut(s)	622
Tru9I	TTAA	1 cut(s)	622
TscAI	CASTG	1 cut(s)	574
TseFI	GTSAC	2 cut(s)	274, 436
Tsp45I	GTSAC	2 cut(s)	274, 436
TspDTI	ATGAA	5 cut(s)	273, 288, 372, 449, 489
TspRI	CASTG	1 cut(s)	574
Van91I	CCANNNNNTGG	1 cut(s)	169
VpaK11BI	GGWCC	2 cut(s)	188, 403
XapI	RAATTY	2 cut(s)	443, 454
XceI	RCATGY	1 cut(s)	297
ZrmI	AGTACT	1 cut(s)	282

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.