Rmu_sc0000367.1_g000109

Bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000367.1
Physical Location & Seq
Forward (+)
470124 .. 473666
3543 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000367.1_g000109.1.cds

Sequence Viewer

Length: 1074 bp
atgatggttcttgacttgaggacacgcgcgtgttggggcagcagggcagcagcggcaacactgggcagcagtgcgatggtgagcaatagcagggacttgacgttgtggtgtgcaaggcgtagggctgcagcaggaggcaggcagcagcagggtgcagtgacagggaggctaggtgcgcaggggctgcggcaggatgctgcagcaggaggcttgcggctaggggtgcaggtagggttttcagcagtttttgttgactgtgggcaacttctcattgcctcctttcaaacttgtggaagcatatcactattttacctgagacattgtctagtcttggccgggccggaagatgaaattaatgtagaaaaagtctcaaaaatgttgaagctacccagcctattagttttggtttgcagcattgttcttgttttgcattcataccaagcaacctcacatgatgaacatgatgaagttgaggatgagagggagtttaattatgacgacaacagtgagaaggggccagctagatggggaaagatacgccatgaatggagcatatgtaacaatggatcgttgcagtctcccatagatctgttagatgacagagttgatgtagtctcagatttagggaaacttcagggtaactacagggcttgcaatgccactcttaagaatagaggccatgatatgatgttgaaatggcatgctgatgcaggatatattccaatcaatggaactcagtatacagtcagacaatgccattggcactcaccttctgaacacaccatcaatggcaagcagtttgatttagaggtgcatctggttcatgacagtccaaatggaagcatcgctgttatcgggatcctgtataagtttggaaaacctgacccatttttgacacggatgatggactacttagaagacttatctgatagcagtaaagaagagaaagtgattggtatggttgatccaaagcaaataaaaactgtcagtacaaagtactacagatatataggctctcttacaactcctccttgcacacaaaatgtcctctggaccattgttggagaggtttaa
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

357

Amino Acids

39.54

Weight (kDa)

6.46

Isoelectric Point (pI)

37.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 177
Acc36I ACCTGC 1 cut(s) 217
AccB7I CCANNNNNTGG 1 cut(s) 728
AccI GTMKAC 1 cut(s) 740
AccII CGCG 2 cut(s) 27, 29
AciI CCGC 3 cut(s) 53, 187, 214
AclWI GGATC 4 cut(s) 574, 853, 866, 959
AcoI YGGCCR 1 cut(s) 333
AcuI CTGAAG 1 cut(s) 617
AfaI GTAC 2 cut(s) 991, 998
AfiI CCNNNNNNNGG 1 cut(s) 728
AflII CTTAAG 1 cut(s) 665
AgsI TTSAA 3 cut(s) 284, 382, 694
AleI CACNNNNGTG 1 cut(s) 28
AluBI AGCT 2 cut(s) 385, 521
AluI AGCT 2 cut(s) 385, 521
Alw26I GTCTC 4 cut(s) 310, 373, 582, 619
AlwI GGATC 4 cut(s) 574, 853, 866, 959
AlwNI CAGNNNCTG 1 cut(s) 184
AoxI GGCC 4 cut(s) 333, 338, 515, 676
AseI ATTAAT 1 cut(s) 354
AspLEI GCGC 2 cut(s) 29, 178
AspS9I GGNCC 3 cut(s) 338, 515, 1053
AsuC2I CCSGG 1 cut(s) 337
AsuHPI GGTGA 2 cut(s) 91, 759
AvaII GGWCC 1 cut(s) 1053
BamHI GGATCC 1 cut(s) 858
BbsI GAAGAC 1 cut(s) 924
BccI CCATC 4 cut(s) 70, 519, 791, 898
BcnI CCSGG 1 cut(s) 337
BcoDI GTCTC 4 cut(s) 310, 373, 582, 619
BfaI CTAG 4 cut(s) 170, 218, 326, 522
BfmI CTRYAG 4 cut(s) 126, 198, 643, 1000
BfrI CTTAAG 1 cut(s) 665
BfuAI ACCTGC 1 cut(s) 217
BglII AGATCT 1 cut(s) 586
BmcAI AGTACT 1 cut(s) 998
Bme1390I CCNGG 1 cut(s) 337
Bme18I GGWCC 1 cut(s) 1053
BmgT120I GGNCC 3 cut(s) 338, 515, 1053
BmiI GGNNCC 2 cut(s) 516, 860
BmrFI CCNGG 1 cut(s) 337
BmrI ACTGGG 1 cut(s) 71
BmsI GCATC 4 cut(s) 184, 697, 823, 852
BmuI ACTGGG 1 cut(s) 71
BpiI GAAGAC 1 cut(s) 924
BpuEI CTTGAG 1 cut(s) 37
BpuMI CCSGG 1 cut(s) 337
BsaXI ACNNNNNCTCC 6 cut(s) 157, 187, 541, 571, 1012, 1042
Bsc4I CCNNNNNNNGG 1 cut(s) 728
Bse1I ACTGG 1 cut(s) 66
Bse3DI GCAATG 2 cut(s) 270, 661
BseGI GGATG 3 cut(s) 199, 481, 906
BseLI CCNNNNNNNGG 1 cut(s) 728
BseMI GCAATG 2 cut(s) 270, 661
BseMII CTCAG 3 cut(s) 305, 630, 749
BseNI ACTGG 1 cut(s) 66
BseRI GAGGAG 1 cut(s) 1017
BseYI CCCAGC 1 cut(s) 389
BsgI GTGCAG 2 cut(s) 174, 245
Bsh1236I CGCG 2 cut(s) 27, 29
BshFI GGCC 4 cut(s) 335, 340, 517, 678
BsiSI CCGG 2 cut(s) 336, 341
BslFI GGGAC 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 728
BsmAI GTCTC 4 cut(s) 310, 373, 582, 619
BsmFI GGGAC 1 cut(s) 107
BsmI GAATGC 1 cut(s) 430
BsnI GGCC 4 cut(s) 335, 340, 517, 678
Bsp143I GATC 4 cut(s) 566, 586, 858, 964
BspACI CCGC 3 cut(s) 53, 187, 214
BspANI GGCC 4 cut(s) 335, 340, 517, 678
BspCNI CTCAG 3 cut(s) 306, 629, 748
BspFNI CGCG 2 cut(s) 27, 29
BspHI TCATGA 1 cut(s) 823
BspLI GGNNCC 2 cut(s) 516, 860
BspMAI CTGCAG 2 cut(s) 130, 202
BspMI ACCTGC 1 cut(s) 217
BspPI GGATC 4 cut(s) 574, 853, 866, 959
BspTI CTTAAG 1 cut(s) 665
BsrDI GCAATG 2 cut(s) 270, 661
BsrI ACTGG 1 cut(s) 66
BssMI GATC 4 cut(s) 566, 586, 858, 964
BssNAI GTATAC 1 cut(s) 741
Bst1107I GTATAC 1 cut(s) 741
Bst4CI ACNGT 5 cut(s) 257, 506, 745, 830, 985
Bst6I CTCTTC 1 cut(s) 936
BstAFI CTTAAG 1 cut(s) 665
BstAPI GCANNNNNTGC 1 cut(s) 184
BstC8I GCNNGC 6 cut(s) 140, 212, 519, 652, 702, 794
BstDEI CTNAG 4 cut(s) 314, 616, 735, 913
BstF5I GGATG 3 cut(s) 199, 481, 906
BstFNI CGCG 2 cut(s) 27, 29
BstHHI GCGC 2 cut(s) 29, 178
BstKTI GATC 4 cut(s) 569, 589, 861, 967
BstMAI GTCTC 4 cut(s) 310, 373, 582, 619
BstMBI GATC 4 cut(s) 566, 586, 858, 964
BstMWI GCNNNNNNNGC 5 cut(s) 53, 175, 184, 223, 656
BstNSI RCATGY 1 cut(s) 704
BstSCI CCNGG 1 cut(s) 335
BstSFI CTRYAG 4 cut(s) 126, 198, 643, 1000
BstUI CGCG 2 cut(s) 27, 29
BstV2I GAAGAC 1 cut(s) 924
BstX2I RGATCY 2 cut(s) 586, 858
BstXI CCANNNNNNTGG 1 cut(s) 525
BstYI RGATCY 2 cut(s) 586, 858
BstZ17I GTATAC 1 cut(s) 741
BsuRI GGCC 4 cut(s) 335, 340, 517, 678
BtgZI GCGATG 2 cut(s) 89, 829
BtsCI GGATG 3 cut(s) 199, 481, 906
BtsI GCAGTG 2 cut(s) 76, 162
BtsIMutI CAGTG 4 cut(s) 59, 76, 162, 511
BveI ACCTGC 1 cut(s) 217
Cac8I GCNNGC 6 cut(s) 140, 212, 519, 652, 702, 794
CaiI CAGNNNCTG 1 cut(s) 184
CciI TCATGA 1 cut(s) 823
CfoI GCGC 2 cut(s) 29, 178
Cfr13I GGNCC 3 cut(s) 338, 515, 1053
Csp6I GTAC 2 cut(s) 990, 997
CviAII CATG 6 cut(s) 452, 461, 542, 680, 701, 824
CviQI GTAC 2 cut(s) 990, 997
DdeI CTNAG 4 cut(s) 314, 616, 735, 913
DpnI GATC 4 cut(s) 568, 588, 860, 966
DpnII GATC 4 cut(s) 566, 586, 858, 964
EaeI YGGCCR 1 cut(s) 333
Eam1104I CTCTTC 1 cut(s) 936
EarI CTCTTC 1 cut(s) 936
Eco47I GGWCC 1 cut(s) 1053
Eco57I CTGAAG 1 cut(s) 617
FaeI CATG 6 cut(s) 455, 464, 545, 683, 704, 827
FaqI GGGAC 1 cut(s) 107
FatI CATG 6 cut(s) 451, 460, 541, 679, 700, 823
FauNDI CATATG 1 cut(s) 554
FblI GTMKAC 1 cut(s) 740
FokI GGATG 3 cut(s) 206, 488, 913
FspBI CTAG 4 cut(s) 170, 218, 326, 522
FspI TGCGCA 1 cut(s) 177
GlaI GCGC 2 cut(s) 28, 177
GsaI CCCAGC 1 cut(s) 393
HaeIII GGCC 4 cut(s) 335, 340, 517, 678
HapII CCGG 2 cut(s) 336, 341
HhaI GCGC 2 cut(s) 29, 178
Hin1II CATG 6 cut(s) 455, 464, 545, 683, 704, 827
Hin6I GCGC 2 cut(s) 27, 176
HinP1I GCGC 2 cut(s) 27, 176
HincII GTYRAC 1 cut(s) 253
HindII GTYRAC 1 cut(s) 253
HpaII CCGG 2 cut(s) 336, 341
HphI GGTGA 2 cut(s) 91, 759
Hpy166II GTNNAC 2 cut(s) 253, 741
Hpy188I TCNGA 4 cut(s) 619, 749, 775, 928
Hpy188III TCNNGA 4 cut(s) 11, 824, 856, 1051
Hpy8I GTNNAC 2 cut(s) 253, 741
HpyAV CCTTC 2 cut(s) 505, 780
HpyCH4III ACNGT 5 cut(s) 257, 506, 745, 830, 985
HpyCH4IV ACGT 1 cut(s) 101
HpyF10VI GCNNNNNNNGC 5 cut(s) 53, 175, 184, 223, 656
HpyF3I CTNAG 4 cut(s) 314, 616, 735, 913
HpySE526I ACGT 1 cut(s) 101
Hsp92II CATG 6 cut(s) 455, 464, 545, 683, 704, 827
HspAI GCGC 2 cut(s) 27, 176
Kzo9I GATC 4 cut(s) 566, 586, 858, 964
LmnI GCTCC 1 cut(s) 549
LweI GCATC 4 cut(s) 184, 697, 823, 852
MaeI CTAG 4 cut(s) 170, 218, 326, 522
MaeII ACGT 1 cut(s) 101
MaeIII GTNAC 3 cut(s) 157, 557, 638
MalI GATC 4 cut(s) 568, 588, 860, 966
MboI GATC 4 cut(s) 566, 586, 858, 964
MboII GAAGA 3 cut(s) 356, 929, 953
MflI RGATCY 2 cut(s) 586, 858
MluCI AATT 2 cut(s) 351, 490
MmeI TCCRAC 1 cut(s) 1042
MseI TTAA 4 cut(s) 354, 489, 666, 1072
MslI CAYNNNNRTG 2 cut(s) 28, 705
MspA1I CMGCKG 1 cut(s) 53
MspCI CTTAAG 1 cut(s) 665
MspI CCGG 2 cut(s) 336, 341
MspR9I CCNGG 1 cut(s) 337
Mva1269I GAATGC 1 cut(s) 430
MvnI CGCG 2 cut(s) 27, 29
MwoI GCNNNNNNNGC 5 cut(s) 53, 175, 184, 223, 656
NciI CCSGG 1 cut(s) 337
NdeI CATATG 1 cut(s) 554
NdeII GATC 4 cut(s) 566, 586, 858, 964
NlaIII CATG 6 cut(s) 455, 464, 545, 683, 704, 827
NlaIV GGNNCC 2 cut(s) 516, 860
NmuCI GTSAC 1 cut(s) 157
NsbI TGCGCA 1 cut(s) 177
NspI RCATGY 1 cut(s) 704
OliI CACNNNNGTG 1 cut(s) 28
PaeI GCATGC 1 cut(s) 704
PagI TCATGA 1 cut(s) 823
PctI GAATGC 1 cut(s) 430
PflFI GACNNNGTC 1 cut(s) 321
PflMI CCANNNNNTGG 1 cut(s) 728
PshBI ATTAAT 1 cut(s) 354
PspFI CCCAGC 1 cut(s) 389
PspN4I GGNNCC 2 cut(s) 516, 860
PspPI GGNCC 3 cut(s) 338, 515, 1053
PsrI GAACNNNNNNTAC 2 cut(s) 724, 756
PstI CTGCAG 2 cut(s) 130, 202
PstNI CAGNNNCTG 1 cut(s) 184
PsuI RGATCY 2 cut(s) 586, 858
PsyI GACNNNGTC 1 cut(s) 321
RsaI GTAC 2 cut(s) 991, 998
RsaNI GTAC 2 cut(s) 990, 997
RseI CAYNNNNRTG 2 cut(s) 28, 705
SaqAI TTAA 4 cut(s) 354, 489, 666, 1072
Sau3AI GATC 4 cut(s) 566, 586, 858, 964
Sau96I GGNCC 3 cut(s) 338, 515, 1053
ScaI AGTACT 1 cut(s) 998
ScrFI CCNGG 1 cut(s) 337
SfaNI GCATC 4 cut(s) 184, 697, 823, 852
SfcI CTRYAG 4 cut(s) 126, 198, 643, 1000
SinI GGWCC 1 cut(s) 1053
SmiMI CAYNNNNRTG 2 cut(s) 28, 705
SmlI CTYRAG 2 cut(s) 16, 665
SmoI CTYRAG 2 cut(s) 16, 665
SphI GCATGC 1 cut(s) 704
Sse9I AATT 2 cut(s) 351, 490
SsiI CCGC 3 cut(s) 53, 187, 214
SspMI CTAG 4 cut(s) 170, 218, 326, 522
StyD4I CCNGG 1 cut(s) 335
TaaI ACNGT 5 cut(s) 257, 506, 745, 830, 985
TaiI ACGT 1 cut(s) 104
TasI AATT 2 cut(s) 351, 490
TatI WGTACW 2 cut(s) 989, 996
TauI GCSGC 3 cut(s) 56, 190, 217
Tru1I TTAA 4 cut(s) 354, 489, 666, 1072
Tru9I TTAA 4 cut(s) 354, 489, 666, 1072
TscAI CASTG 4 cut(s) 66, 76, 162, 511
TseFI GTSAC 1 cut(s) 157
Tsp45I GTSAC 1 cut(s) 157
TspDTI ATGAA 6 cut(s) 363, 423, 471, 480, 558, 812
TspGWI ACGGA 1 cut(s) 913
TspRI CASTG 4 cut(s) 66, 76, 162, 511
Tth111I GACNNNGTC 1 cut(s) 321
Van91I CCANNNNNTGG 1 cut(s) 728
Vha464I CTTAAG 1 cut(s) 665
VpaK11BI GGWCC 1 cut(s) 1053
VspI ATTAAT 1 cut(s) 354
XceI RCATGY 1 cut(s) 704
XmiI GTMKAC 1 cut(s) 740
XspI CTAG 4 cut(s) 170, 218, 326, 522
ZrmI AGTACT 1 cut(s) 998
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.