Rh5BG378800

Bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0006048
Physical Location & Seq
Reverse (-)
59966246 .. 59984393
18148 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG378800.1

Sequence Viewer

Length: 717 bp
ATGGTTGGAGTGTTGAAAGATACCATCAAGAAGCTGGACTGCACTTACCAGGATCAGAGGGAGTTTAGTTATGACGCCAACAGTGAGAAGGGGCCAGCTAGATGGGGAAAGATACGCCATGAATGGAGCATGTGTAACAATGGATCGTTGCAGTCTCCGATCGATCTGTTAGATGACAGAGTTGATGTAGTCTCAGATTTAGGGACACTTCAGGATAGCTACAGGGCTTGCAATGCCACTCTTAAGAATAGAGGCCATGATATGATGTTGAAATGGCAAGCTGATGCAGGATACATTCCAATCAATGGAACTCAGTATACAGTTAGACAATGCCACTGGCACTCACCTTCTGAACACACCATCAATGGCAAGCAGTTTGATTTAGAGGTGCATCTGGTTCATGACAGTCCAAATGCAAGCATCGCTGTTATCGGAATCCTGTATAAGATTGGAAAACCTGACCCATTTTTGACACAGATGATGGACCACTTGGAAGACTTATCTGATAGCAGTAAAGAAGAGAAAGTGATTGGTATGGTTGATCCAAAGCAAATAAAAATTGTCAGTACAAAGTACTACAGATATATAGGCTCTCTTACAACTCCTCCTTGCACACAAGATGTCCTATGGACCCTTGTTGAAGAGGTGAGGACTGTCTCTAAAGAACAGGTCAAATTCCTCCGCAAAGCTGTTCACGATAGAATAAAGCAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0008150 GO:0010033 GO:0010037 GO:0016020 GO:0042221 GO:0042493 GO:0050896 GO:0072347 GO:1901700
KEGG Pathways
Metabolic & Signaling
ko00910 map00910
Pfam Domains
Protein Families
Carb_anhydrase

Protein Analysis

238

Amino Acids

27.25

Weight (kDa)

6.75

Isoelectric Point (pI)

32.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Carb_anhydrase PF00194 31 - 234 1.1e-38 Eukaryotic-type carbonic anhydrase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 305
AccI GTMKAC 1 cut(s) 317
AciI CCGC 1 cut(s) 682
AclWI GGATC 3 cut(s) 60, 151, 536
AcsI RAATTY 1 cut(s) 674
AcuI CTGAAG 1 cut(s) 194
AcyI GRCGYC 1 cut(s) 75
AfaI GTAC 2 cut(s) 568, 575
AfiI CCNNNNNNNGG 1 cut(s) 305
AflII CTTAAG 1 cut(s) 242
AgsI TTSAA 3 cut(s) 16, 271, 641
AjnI CCWGG 1 cut(s) 48
AluBI AGCT 5 cut(s) 34, 98, 219, 281, 689
AluI AGCT 5 cut(s) 34, 98, 219, 281, 689
Alw26I GTCTC 3 cut(s) 159, 196, 661
AlwI GGATC 3 cut(s) 60, 151, 536
AoxI GGCC 2 cut(s) 92, 253
ApoI RAATTY 1 cut(s) 674
AspS9I GGNCC 3 cut(s) 92, 484, 630
AsuHPI GGTGA 2 cut(s) 336, 658
AvaII GGWCC 2 cut(s) 484, 630
BbsI GAAGAC 1 cut(s) 501
BccI CCATC 4 cut(s) 32, 96, 368, 475
BciT130I CCWGG 1 cut(s) 50
BciVI GTATCC 1 cut(s) 284
BcoDI GTCTC 3 cut(s) 159, 196, 661
BfaI CTAG 1 cut(s) 99
BfmI CTRYAG 2 cut(s) 220, 577
BfrI CTTAAG 1 cut(s) 242
BfuI GTATCC 1 cut(s) 284
BmcAI AGTACT 1 cut(s) 575
Bme1390I CCNGG 1 cut(s) 50
Bme18I GGWCC 2 cut(s) 484, 630
BmgT120I GGNCC 3 cut(s) 92, 484, 630
BmiI GGNNCC 2 cut(s) 93, 632
BmrFI CCNGG 1 cut(s) 50
BmsI GCATC 3 cut(s) 274, 400, 429
BpiI GAAGAC 1 cut(s) 501
Bsa29I ATCGAT 1 cut(s) 162
BsaHI GRCGYC 1 cut(s) 75
BsaXI ACNNNNNCTCC 4 cut(s) 118, 148, 589, 619
Bsc4I CCNNNNNNNGG 1 cut(s) 305
Bse1I ACTGG 1 cut(s) 341
Bse3DI GCAATG 1 cut(s) 238
BseBI CCWGG 1 cut(s) 50
BseCI ATCGAT 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 305
BseMI GCAATG 1 cut(s) 238
BseMII CTCAG 2 cut(s) 207, 326
BseNI ACTGG 1 cut(s) 341
BseRI GAGGAG 1 cut(s) 594
BsgI GTGCAG 1 cut(s) 25
Bsh1285I CGRYCG 1 cut(s) 162
BshFI GGCC 2 cut(s) 94, 255
BshVI ATCGAT 1 cut(s) 162
BsiEI CGRYCG 1 cut(s) 162
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 1 cut(s) 305
BsmAI GTCTC 3 cut(s) 159, 196, 661
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 2 cut(s) 94, 255
Bsp143I GATC 5 cut(s) 52, 143, 159, 163, 541
BspACI CCGC 1 cut(s) 682
BspANI GGCC 2 cut(s) 94, 255
BspCNI CTCAG 2 cut(s) 206, 325
BspDI ATCGAT 1 cut(s) 162
BspHI TCATGA 1 cut(s) 400
BspLI GGNNCC 2 cut(s) 93, 632
BspPI GGATC 3 cut(s) 60, 151, 536
BspTI CTTAAG 1 cut(s) 242
BsrDI GCAATG 1 cut(s) 238
BsrI ACTGG 1 cut(s) 341
BssMI GATC 5 cut(s) 52, 143, 159, 163, 541
BssNAI GTATAC 1 cut(s) 318
BssNI GRCGYC 1 cut(s) 75
Bst1107I GTATAC 1 cut(s) 318
Bst2UI CCWGG 1 cut(s) 50
Bst4CI ACNGT 4 cut(s) 83, 322, 407, 655
Bst6I CTCTTC 2 cut(s) 513, 636
BstACI GRCGYC 1 cut(s) 75
BstAFI CTTAAG 1 cut(s) 242
BstC8I GCNNGC 5 cut(s) 96, 229, 279, 371, 418
BstDEI CTNAG 2 cut(s) 193, 312
BstKTI GATC 5 cut(s) 55, 146, 162, 166, 544
BstMAI GTCTC 3 cut(s) 159, 196, 661
BstMBI GATC 5 cut(s) 52, 143, 159, 163, 541
BstMCI CGRYCG 1 cut(s) 162
BstMWI GCNNNNNNNGC 2 cut(s) 233, 422
BstNI CCWGG 1 cut(s) 50
BstNSI RCATGY 1 cut(s) 133
BstSCI CCNGG 1 cut(s) 48
BstSFI CTRYAG 2 cut(s) 220, 577
BstV2I GAAGAC 1 cut(s) 501
BstXI CCANNNNNNTGG 1 cut(s) 102
BstZ17I GTATAC 1 cut(s) 318
Bsu15I ATCGAT 1 cut(s) 162
BsuI GTATCC 1 cut(s) 284
BsuRI GGCC 2 cut(s) 94, 255
BsuTUI ATCGAT 1 cut(s) 162
BtgZI GCGATG 1 cut(s) 406
BtsIMutI CAGTG 2 cut(s) 88, 334
Cac8I GCNNGC 5 cut(s) 96, 229, 279, 371, 418
CciI TCATGA 1 cut(s) 400
Cfr13I GGNCC 3 cut(s) 92, 484, 630
ClaI ATCGAT 1 cut(s) 162
CseI GACGC 1 cut(s) 83
Csp6I GTAC 2 cut(s) 567, 574
CviAII CATG 4 cut(s) 119, 130, 257, 401
CviJI RGCY 9 cut(s) 34, 94, 98, 219, 227, 255, 281, 591, 689
CviKI_1 RGCY 9 cut(s) 34, 94, 98, 219, 227, 255, 281, 591, 689
CviQI GTAC 2 cut(s) 567, 574
DdeI CTNAG 2 cut(s) 193, 312
DpnI GATC 5 cut(s) 54, 145, 161, 165, 543
DpnII GATC 5 cut(s) 52, 143, 159, 163, 541
Eam1104I CTCTTC 2 cut(s) 513, 636
EarI CTCTTC 2 cut(s) 513, 636
Eco47I GGWCC 2 cut(s) 484, 630
Eco57I CTGAAG 1 cut(s) 194
EcoRII CCWGG 1 cut(s) 48
FaeI CATG 4 cut(s) 122, 133, 260, 404
FaqI GGGAC 1 cut(s) 217
FatI CATG 4 cut(s) 118, 129, 256, 400
FblI GTMKAC 1 cut(s) 317
FspBI CTAG 1 cut(s) 99
HaeIII GGCC 2 cut(s) 94, 255
HgaI GACGC 1 cut(s) 83
Hin1I GRCGYC 1 cut(s) 75
Hin1II CATG 4 cut(s) 122, 133, 260, 404
HinfI GANTC 1 cut(s) 435
HphI GGTGA 2 cut(s) 336, 658
Hpy166II GTNNAC 2 cut(s) 318, 694
Hpy188I TCNGA 6 cut(s) 57, 159, 196, 352, 434, 505
Hpy188III TCNNGA 4 cut(s) 28, 212, 401, 695
Hpy8I GTNNAC 2 cut(s) 318, 694
HpyAV CCTTC 2 cut(s) 82, 357
HpyCH4III ACNGT 4 cut(s) 83, 322, 407, 655
HpyCH4V TGCA 7 cut(s) 42, 151, 231, 287, 391, 416, 612
HpyF10VI GCNNNNNNNGC 2 cut(s) 233, 422
HpyF3I CTNAG 2 cut(s) 193, 312
Hsp92I GRCGYC 1 cut(s) 75
Hsp92II CATG 4 cut(s) 122, 133, 260, 404
Kzo9I GATC 5 cut(s) 52, 143, 159, 163, 541
LmnI GCTCC 1 cut(s) 126
LweI GCATC 3 cut(s) 274, 400, 429
MaeI CTAG 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 134
MalI GATC 5 cut(s) 54, 145, 161, 165, 543
MboI GATC 5 cut(s) 52, 143, 159, 163, 541
MboII GAAGA 3 cut(s) 506, 530, 653
MluCI AATT 2 cut(s) 558, 674
MnlI CCTC 7 cut(s) 51, 245, 379, 615, 637, 642, 689
MseI TTAA 1 cut(s) 243
MspCI CTTAAG 1 cut(s) 242
MspR9I CCNGG 1 cut(s) 50
MvaI CCWGG 1 cut(s) 50
MwoI GCNNNNNNNGC 2 cut(s) 233, 422
NdeII GATC 5 cut(s) 52, 143, 159, 163, 541
NlaIII CATG 4 cut(s) 122, 133, 260, 404
NlaIV GGNNCC 2 cut(s) 93, 632
NspI RCATGY 1 cut(s) 133
PagI TCATGA 1 cut(s) 400
PfeI GAWTC 1 cut(s) 435
PflMI CCANNNNNTGG 1 cut(s) 305
Ple19I CGATCG 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 48
PspGI CCWGG 1 cut(s) 48
PspN4I GGNNCC 2 cut(s) 93, 632
PspPI GGNCC 3 cut(s) 92, 484, 630
PsrI GAACNNNNNNTAC 2 cut(s) 301, 333
PvuI CGATCG 1 cut(s) 162
RsaI GTAC 2 cut(s) 568, 575
RsaNI GTAC 2 cut(s) 567, 574
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 5 cut(s) 52, 143, 159, 163, 541
Sau96I GGNCC 3 cut(s) 92, 484, 630
ScaI AGTACT 1 cut(s) 575
ScrFI CCNGG 1 cut(s) 50
SfaNI GCATC 3 cut(s) 274, 400, 429
SfcI CTRYAG 2 cut(s) 220, 577
SinI GGWCC 2 cut(s) 484, 630
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 2 cut(s) 558, 674
SsiI CCGC 1 cut(s) 682
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 48
TaaI ACNGT 4 cut(s) 83, 322, 407, 655
TaqI TCGA 1 cut(s) 162
TasI AATT 2 cut(s) 558, 674
TatI WGTACW 2 cut(s) 566, 573
TfiI GAWTC 1 cut(s) 435
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TscAI CASTG 2 cut(s) 88, 341
TspDTI ATGAA 2 cut(s) 135, 389
TspRI CASTG 2 cut(s) 88, 341
Van91I CCANNNNNTGG 1 cut(s) 305
Vha464I CTTAAG 1 cut(s) 242
VpaK11BI GGWCC 2 cut(s) 484, 630
XapI RAATTY 1 cut(s) 674
XceI RCATGY 1 cut(s) 133
XcmI CCANNNNNNNNNTGG 1 cut(s) 31
XmiI GTMKAC 1 cut(s) 317
XspI CTAG 1 cut(s) 99
ZrmI AGTACT 1 cut(s) 575
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.