Rmu_sc0000394.1_g000060

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000394.1
Physical Location & Seq
Reverse (-)
206915 .. 207163
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000394.1_g000060.1.cds

Sequence Viewer

Length: 249 bp
atgagtaacctgaacaaattggactttgctccattggaaataactggctctgaatatcacaggtgggttcatgatatcagccagcatctcaaggccgatggaatcttggatacgattctcgagcctagacaggacgtgctaactgttgagcaagctcaagctttggaagcaaatagagcagccttagaggcaaataaggcgaaagctgccatcatcctaatgactcgtcatatggatgattcgctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.21

Weight (kDa)

5.15

Isoelectric Point (pI)

49.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjiI CACGTC 1 cut(s) 136
AluBI AGCT 3 cut(s) 155, 161, 206
AluI AGCT 3 cut(s) 155, 161, 206
Ama87I CYCGRG 1 cut(s) 119
AoxI GGCC 1 cut(s) 93
ApeKI GCWGC 2 cut(s) 179, 206
AvaI CYCGRG 1 cut(s) 119
BbvI GCAGC 2 cut(s) 191, 193
BccI CCATC 2 cut(s) 92, 218
BciVI GTATCC 1 cut(s) 103
BfaI CTAG 2 cut(s) 126, 247
BfuI GTATCC 1 cut(s) 103
BglI GCCNNNNNGGC 1 cut(s) 188
BisI GCNGC 2 cut(s) 180, 207
BlsI GCNGC 2 cut(s) 181, 208
BmeT110I CYCGRG 1 cut(s) 119
BmgBI CACGTC 1 cut(s) 136
BmsI GCATC 1 cut(s) 94
BpuEI CTTGAG 2 cut(s) 74, 141
Bse1I ACTGG 1 cut(s) 49
BseGI GGATG 2 cut(s) 213, 241
BseNI ACTGG 1 cut(s) 49
BseXI GCAGC 2 cut(s) 191, 193
BshFI GGCC 1 cut(s) 95
BsiHKCI CYCGRG 1 cut(s) 119
BsnI GGCC 1 cut(s) 95
BsoBI CYCGRG 1 cut(s) 119
BspANI GGCC 1 cut(s) 95
BspHI TCATGA 1 cut(s) 70
BsrI ACTGG 1 cut(s) 49
Bst4CI ACNGT 1 cut(s) 145
BstC8I GCNNGC 2 cut(s) 83, 153
BstDEI CTNAG 1 cut(s) 184
BstF5I GGATG 2 cut(s) 213, 241
BstMWI GCNNNNNNNGC 5 cut(s) 167, 176, 188, 197, 206
BstV1I GCAGC 2 cut(s) 191, 193
BsuI GTATCC 1 cut(s) 103
BsuRI GGCC 1 cut(s) 95
BtrI CACGTC 1 cut(s) 136
BtsCI GGATG 2 cut(s) 213, 241
Cac8I GCNNGC 2 cut(s) 83, 153
CciI TCATGA 1 cut(s) 70
CviAII CATG 1 cut(s) 71
CviJI RGCY 8 cut(s) 48, 81, 95, 124, 155, 161, 182, 206
CviKI_1 RGCY 8 cut(s) 48, 81, 95, 124, 155, 161, 182, 206
DdeI CTNAG 1 cut(s) 184
Eco32I GATATC 1 cut(s) 76
Eco88I CYCGRG 1 cut(s) 119
EcoRV GATATC 1 cut(s) 76
FaeI CATG 1 cut(s) 74
FaiI YATR 3 cut(s) 72, 231, 233
FatI CATG 1 cut(s) 70
FauNDI CATATG 1 cut(s) 231
Fnu4HI GCNGC 2 cut(s) 180, 207
FokI GGATG 1 cut(s) 200
Fsp4HI GCNGC 2 cut(s) 180, 207
FspBI CTAG 2 cut(s) 126, 247
GluI GCNGC 2 cut(s) 180, 207
HaeIII GGCC 1 cut(s) 95
Hin1II CATG 1 cut(s) 74
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 4 cut(s) 102, 115, 223, 239
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 2 cut(s) 71, 119
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4IV ACGT 1 cut(s) 135
HpyF10VI GCNNNNNNNGC 5 cut(s) 167, 176, 188, 197, 206
HpyF3I CTNAG 1 cut(s) 184
HpySE526I ACGT 1 cut(s) 135
Hsp92II CATG 1 cut(s) 74
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 5 cut(s) 23, 30, 46, 95, 116
Lsp1109I GCAGC 2 cut(s) 191, 193
LweI GCATC 1 cut(s) 94
MaeI CTAG 2 cut(s) 126, 247
MaeII ACGT 1 cut(s) 135
MaeIII GTNAC 1 cut(s) 5
MluCI AATT 1 cut(s) 17
MlyI GAGTC 1 cut(s) 217
MnlI CCTC 1 cut(s) 181
MslI CAYNNNNRTG 2 cut(s) 218, 234
MwoI GCNNNNNNNGC 5 cut(s) 167, 176, 188, 197, 206
NdeI CATATG 1 cut(s) 231
NlaIII CATG 1 cut(s) 74
PaeR7I CTCGAG 1 cut(s) 119
PagI TCATGA 1 cut(s) 70
PfeI GAWTC 3 cut(s) 102, 115, 239
PkrI GCNGC 2 cut(s) 181, 208
PleI GAGTC 1 cut(s) 217
PpsI GAGTC 1 cut(s) 217
RseI CAYNNNNRTG 2 cut(s) 218, 234
SatI GCNGC 2 cut(s) 180, 207
SchI GAGTC 1 cut(s) 217
SetI ASST 6 cut(s) 12, 65, 138, 157, 163, 208
SfaNI GCATC 1 cut(s) 94
Sfr274I CTCGAG 1 cut(s) 119
SlaI CTCGAG 1 cut(s) 119
SmiMI CAYNNNNRTG 2 cut(s) 218, 234
SmlI CTYRAG 3 cut(s) 89, 119, 156
SmoI CTYRAG 3 cut(s) 89, 119, 156
Sse9I AATT 1 cut(s) 17
SspMI CTAG 2 cut(s) 126, 247
TaaI ACNGT 1 cut(s) 145
TaiI ACGT 1 cut(s) 138
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 17
TfiI GAWTC 3 cut(s) 102, 115, 239
TseI GCWGC 2 cut(s) 179, 206
TspDTI ATGAA 1 cut(s) 59
XhoI CTCGAG 1 cut(s) 119
XspI CTAG 2 cut(s) 126, 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.