Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr4

Orthogroup ID

OG0006963

Physical Location & Seq

Genomic Coordinates Reverse (-)

44297681 .. 44298115

Gene Structure 435 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw4G020380.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 435 bp

ATGATCTTCGCTTCTCTGAATTTGACACTGTCATGCAATTCTATTCAGAAGCCCAACCAATTGATTGAGAAAAACCTCAATACCTTCCCCATCCATGCTATGAGGTCCTCTAATTTATTTCGGACTCATGTAAATGCTAGATGGATCACAAGTTTTCAACAGCTTATTGAAGCTATGGCCACTACTGAAAGACGTGGCAACGAGCTTGTGAAAAGAAAATTGATAGGCTTCAAGATAGCCATCAAGAGCATCGTCCTATGGCTAGAGAGAGTCGCAATCGACATCATGATCCATACGATCGATATGCTCAAGAAGGTAATCGCTCAAGGTGACAATCACATGACCGTAGGAGGGGTGATTTTGAGGGATGTAGGGTTGGAAACCATGGAGCCAACATTGGCCATGGGCACCACTTTCCAATGCCACCAGTCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

144

Amino Acids

16.32

Weight (kDa)

9.62

Isoelectric Point (pI)

42.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006963)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0323081 RchiOBHm_Chr2g0168921 RchiOBHm_Chr3g0488021 RchiOBHm_Chr7g0240151
rosa_multiflora	Rmu_sc0000394.1_g000060 Rmu_sc0006867.1_g000028 Rmu_sc0015156.1_g000005
rosa_roxburghii	Rroxscaffold_2G00110370 Rroxscaffold_4G00296000 Rroxscaffold_4G00296010 Rroxscaffold_5G00378770
rosa_rugosa	Rorug06G0510400
rosa_samantha	Rh2BG204600 Rh2BG204700 Rh2BG440000 Rh2BG539600 Rh2DG026100 Rh2DG291000 Rh4CG266000 Rh5BG195600 Rh6AG373800 Rh6DG133200 Rh7CG424800 Rh7CG511100
rosa_wichuraiana	Rw4G020380 Rw6G018910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	407
AclWI	GGATC	2 cut(s)	152, 283
AcoI	YGGCCR	2 cut(s)	177, 399
AcsI	RAATTY	1 cut(s)	19
AfiI	CCNNNNNNNGG	1 cut(s)	351
AgsI	TTSAA	3 cut(s)	158, 170, 232
AjiI	CACGTC	1 cut(s)	194
AluBI	AGCT	3 cut(s)	163, 173, 205
AluI	AGCT	3 cut(s)	163, 173, 205
AlwI	GGATC	2 cut(s)	152, 283
AoxI	GGCC	2 cut(s)	177, 399
ApoI	RAATTY	1 cut(s)	19
AspS9I	GGNCC	1 cut(s)	105
AsuHPI	GGTGA	2 cut(s)	341, 367
AvaII	GGWCC	1 cut(s)	105
BaeGI	GKGCMC	1 cut(s)	410
BalI	TGGCCA	2 cut(s)	179, 401
BanI	GGYRCC	1 cut(s)	407
BccI	CCATC	3 cut(s)	98, 135, 248
BcgI	CGANNNNNNTGC	2 cut(s)	286, 320
BfaI	CTAG	3 cut(s)	138, 263, 433
Bme18I	GGWCC	1 cut(s)	105
BmgBI	CACGTC	1 cut(s)	194
BmgT120I	GGNCC	1 cut(s)	105
BmiI	GGNNCC	2 cut(s)	390, 409
BmsI	GCATC	1 cut(s)	258
BpuEI	CTTGAG	2 cut(s)	293, 309
Bsa29I	ATCGAT	1 cut(s)	300
BsaBI	GATNNNNATC	1 cut(s)	239
BsaJI	CCNNGG	2 cut(s)	384, 402
Bsc4I	CCNNNNNNNGG	1 cut(s)	351
Bse1I	ACTGG	1 cut(s)	427
Bse8I	GATNNNNATC	1 cut(s)	239
BseCI	ATCGAT	1 cut(s)	300
BseDI	CCNNGG	2 cut(s)	384, 402
BseGI	GGATG	2 cut(s)	90, 373
BseJI	GATNNNNATC	1 cut(s)	239
BseLI	CCNNNNNNNGG	1 cut(s)	351
BseNI	ACTGG	1 cut(s)	427
BseSI	GKGCMC	1 cut(s)	410
Bsh1285I	CGRYCG	1 cut(s)	300
BshFI	GGCC	2 cut(s)	179, 401
BshNI	GGYRCC	1 cut(s)	407
BshVI	ATCGAT	1 cut(s)	300
BsiEI	CGRYCG	1 cut(s)	300
BslI	CCNNNNNNNGG	1 cut(s)	351
BsnI	GGCC	2 cut(s)	179, 401
Bsp1286I	GDGCHC	1 cut(s)	410
Bsp143I	GATC	4 cut(s)	3, 144, 288, 297
Bsp19I	CCATGG	2 cut(s)	384, 402
BspANI	GGCC	2 cut(s)	179, 401
BspDI	ATCGAT	1 cut(s)	300
BspHI	TCATGA	1 cut(s)	285
BspLI	GGNNCC	2 cut(s)	390, 409
BspPI	GGATC	2 cut(s)	152, 283
BspT107I	GGYRCC	1 cut(s)	407
BsrI	ACTGG	1 cut(s)	427
BssECI	CCNNGG	2 cut(s)	384, 402
BssMI	GATC	4 cut(s)	3, 144, 288, 297
BssT1I	CCWWGG	2 cut(s)	384, 402
Bst4CI	ACNGT	2 cut(s)	30, 346
BstDSI	CCRYGG	2 cut(s)	384, 402
BstF5I	GGATG	2 cut(s)	90, 373
BstKTI	GATC	4 cut(s)	6, 147, 291, 300
BstMBI	GATC	4 cut(s)	3, 144, 288, 297
BstMCI	CGRYCG	1 cut(s)	300
BstSLI	GKGCMC	1 cut(s)	410
Bsu15I	ATCGAT	1 cut(s)	300
BsuRI	GGCC	2 cut(s)	179, 401
BsuTUI	ATCGAT	1 cut(s)	300
BtgI	CCRYGG	2 cut(s)	384, 402
BtrI	CACGTC	1 cut(s)	194
BtsCI	GGATG	2 cut(s)	90, 373
BtsIMutI	CAGTG	1 cut(s)	26
CciI	TCATGA	1 cut(s)	285
Cfr13I	GGNCC	1 cut(s)	105
ClaI	ATCGAT	1 cut(s)	300
CviAII	CATG	7 cut(s)	33, 95, 128, 286, 340, 385, 403
DpnI	GATC	4 cut(s)	5, 146, 290, 299
DpnII	GATC	4 cut(s)	3, 144, 288, 297
EaeI	YGGCCR	2 cut(s)	177, 399
Eco130I	CCWWGG	2 cut(s)	384, 402
Eco47I	GGWCC	1 cut(s)	105
EcoO109I	RGGNCCY	1 cut(s)	105
EcoT14I	CCWWGG	2 cut(s)	384, 402
ErhI	CCWWGG	2 cut(s)	384, 402
FaeI	CATG	7 cut(s)	36, 98, 131, 289, 343, 388, 406
FatI	CATG	7 cut(s)	32, 94, 127, 285, 339, 384, 402
FokI	GGATG	2 cut(s)	77, 380
FspBI	CTAG	3 cut(s)	138, 263, 433
HaeIII	GGCC	2 cut(s)	179, 401
Hin1II	CATG	7 cut(s)	36, 98, 131, 289, 343, 388, 406
HinfI	GANTC	2 cut(s)	124, 270
HphI	GGTGA	2 cut(s)	341, 367
Hpy188I	TCNGA	3 cut(s)	18, 48, 123
Hpy188III	TCNNGA	4 cut(s)	232, 244, 286, 310
HpyAV	CCTTC	2 cut(s)	94, 307
HpyCH4III	ACNGT	2 cut(s)	30, 346
HpyCH4IV	ACGT	1 cut(s)	193
HpyCH4V	TGCA	1 cut(s)	36
HpySE526I	ACGT	1 cut(s)	193
Hsp92II	CATG	7 cut(s)	36, 98, 131, 289, 343, 388, 406
Kzo9I	GATC	4 cut(s)	3, 144, 288, 297
LmnI	GCTCC	1 cut(s)	388
LweI	GCATC	1 cut(s)	258
MaeI	CTAG	3 cut(s)	138, 263, 433
MaeII	ACGT	1 cut(s)	193
MaeIII	GTNAC	1 cut(s)	329
MalI	GATC	4 cut(s)	5, 146, 290, 299
MboI	GATC	4 cut(s)	3, 144, 288, 297
MfeI	CAATTG	1 cut(s)	59
MhlI	GDGCHC	1 cut(s)	410
MlsI	TGGCCA	2 cut(s)	179, 401
MluCI	AATT	5 cut(s)	19, 37, 59, 112, 218
MluNI	TGGCCA	2 cut(s)	179, 401
MlyI	GAGTC	2 cut(s)	118, 279
MmeI	TCCRAC	1 cut(s)	357
MnlI	CCTC	5 cut(s)	86, 96, 118, 344, 357
Mox20I	TGGCCA	2 cut(s)	179, 401
MscI	TGGCCA	2 cut(s)	179, 401
MslI	CAYNNNNRTG	2 cut(s)	31, 132
Msp20I	TGGCCA	2 cut(s)	179, 401
MunI	CAATTG	1 cut(s)	59
NcoI	CCATGG	2 cut(s)	384, 402
NdeII	GATC	4 cut(s)	3, 144, 288, 297
NlaIII	CATG	7 cut(s)	36, 98, 131, 289, 343, 388, 406
NlaIV	GGNNCC	2 cut(s)	390, 409
NmuCI	GTSAC	1 cut(s)	329
PagI	TCATGA	1 cut(s)	285
PflFI	GACNNNGTC	1 cut(s)	28
Ple19I	CGATCG	1 cut(s)	300
PleI	GAGTC	2 cut(s)	118, 278
PpsI	GAGTC	2 cut(s)	118, 278
PpuMI	RGGWCCY	1 cut(s)	105
Psp5II	RGGWCCY	1 cut(s)	105
PspN4I	GGNNCC	2 cut(s)	390, 409
PspPI	GGNCC	1 cut(s)	105
PspPPI	RGGWCCY	1 cut(s)	105
PsyI	GACNNNGTC	1 cut(s)	28
PvuI	CGATCG	1 cut(s)	300
RseI	CAYNNNNRTG	2 cut(s)	31, 132
Sau3AI	GATC	4 cut(s)	3, 144, 288, 297
Sau96I	GGNCC	1 cut(s)	105
SchI	GAGTC	2 cut(s)	118, 279
SduI	GDGCHC	1 cut(s)	410
SetI	ASST	9 cut(s)	78, 86, 107, 165, 175, 196, 207, 318, 331
SfaNI	GCATC	1 cut(s)	258
SinI	GGWCC	1 cut(s)	105
SmiMI	CAYNNNNRTG	2 cut(s)	31, 132
SmlI	CTYRAG	2 cut(s)	308, 324
SmoI	CTYRAG	2 cut(s)	308, 324
Sse9I	AATT	5 cut(s)	19, 37, 59, 112, 218
SspMI	CTAG	3 cut(s)	138, 263, 433
StyI	CCWWGG	2 cut(s)	384, 402
TaaI	ACNGT	2 cut(s)	30, 346
TaiI	ACGT	1 cut(s)	196
TaqI	TCGA	2 cut(s)	279, 300
TasI	AATT	5 cut(s)	19, 37, 59, 112, 218
TscAI	CASTG	1 cut(s)	33
TseFI	GTSAC	1 cut(s)	329
Tsp45I	GTSAC	1 cut(s)	329
TspRI	CASTG	1 cut(s)	33
Tth111I	GACNNNGTC	1 cut(s)	28
VpaK11BI	GGWCC	1 cut(s)	105
XapI	RAATTY	1 cut(s)	19
XspI	CTAG	3 cut(s)	138, 263, 433

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.