Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000420.1

Orthogroup ID

OG0004073

Physical Location & Seq

Genomic Coordinates Forward (+)

42240 .. 43761

Gene Structure 1522 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000420.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 705 bp

atggagtgcagtactgacactagcattaacacaacaaacactacctatgccccatcaacccctttctctcatcaatctccttcttcttcccaatcatcttctcctccaattactccaactcaaactgttactcaagctcaaactcaaattccaccaccccagaatgttgtggtcagtccttgtgctgcttgcaagatcttgagaagaagatgtgcagagaaatgtgtgttggctccttactttcctccctctgagccagccaagttcaccatagcacatcgagtctttggtgctagcaacatcatcaagttcttgcaggaccttccagaatctcaaagggctgatgcagtgagcagcatggtttatgaggccagtgcaagaatcagagacccagtctatggttgtgcaggggcaatctgccatctccaaaaacaagtgagtgaccttcaagcacaattggccaaggcacaagctgaggttgtcaacatgcagtgccagcaagcaaaccttgtagcactgctcatggaaatggcaaaacccgatcaccacgaacagggatccccggatcaacaatcactcgatcatcacaacttcatcaccagccctcttcctcatagcaatatactcaatcagagcaacttgagcttccttgatgatcataactctgctctaggcgcattctgggaattaccgctttggacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LOB

Protein Analysis

234

Amino Acids

25.57

Weight (kDa)

5.95

Isoelectric Point (pI)

67.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004073)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G07900 AT2G28500
fragaria_vesca	FvH4_3g33510 FvH4_7g20130
malus_domestica	MD01G1130900.v1.1 MD03G1111600.v1.1 MD07G1178900.v1.1 MD11G1125200.v1.1
prunus_persica	Prupe.2G218000_v2.0.a1 Prupe.6G093900_v2.0.a1
pyrus_communis	pycom01g13960 pycom07g17260 pycom11g10580
rosa_chinensis	RchiOBHm_Chr1g0364081 RchiOBHm_Chr5g0060941
rosa_laevigata	RLG00000027518 RLG00000035417
rosa_multiflora	Rmu_sc0000071.1_g000023 Rmu_sc0000420.1_g000003
rosa_roxburghii	Rroxscaffold_1G00019690 Rroxscaffold_4G00292660
rosa_rugosa	Rorug01G0313300 Rorug05G0335400
rosa_samantha	Rh1AG320800 Rh1BG284000 Rh1CG300400 Rh1DG315400 Rh5AG398000 Rh5BG410700 Rh5CG435900 Rh5DG425200
rosa_wichuraiana	Rw1G028440 Rw5G037530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	398
AciI	CCGC	1 cut(s)	692
AclWI	GGATC	3 cut(s)	552, 565, 573
AcoI	YGGCCR	1 cut(s)	459
AcsI	RAATTY	1 cut(s)	147
AfaI	GTAC	1 cut(s)	13
AfiI	CCNNNNNNNGG	2 cut(s)	398, 553
AgsI	TTSAA	1 cut(s)	449
AjuI	GAANNNNNNNTTGG	2 cut(s)	212, 244
AluBI	AGCT	3 cut(s)	137, 473, 645
AluI	AGCT	3 cut(s)	137, 473, 645
Alw26I	GTCTC	1 cut(s)	381
AlwI	GGATC	3 cut(s)	552, 565, 573
AoxI	GGCC	2 cut(s)	369, 459
ApeKI	GCWGC	2 cut(s)	185, 354
ApoI	RAATTY	1 cut(s)	147
AspLEI	GCGC	1 cut(s)	677
AspS9I	GGNCC	1 cut(s)	319
AsuC2I	CCSGG	1 cut(s)	563
AsuHPI	GGTGA	3 cut(s)	259, 536, 589
AsuNHI	GCTAGC	1 cut(s)	293
AvaII	GGWCC	1 cut(s)	319
BalI	TGGCCA	1 cut(s)	461
BamHI	GGATCC	1 cut(s)	557
BbvCI	CCTCAGC	1 cut(s)	474
BbvI	GCAGC	2 cut(s)	172, 366
BccI	CCATC	2 cut(s)	61, 429
BclI	TGATCA	1 cut(s)	655
BcnI	CCSGG	1 cut(s)	563
BcoDI	GTCTC	1 cut(s)	381
BfaI	CTAG	3 cut(s)	21, 294, 671
BglII	AGATCT	1 cut(s)	195
BisI	GCNGC	2 cut(s)	186, 355
BlsI	GCNGC	2 cut(s)	187, 356
BmcAI	AGTACT	1 cut(s)	13
Bme1390I	CCNGG	1 cut(s)	563
Bme18I	GGWCC	1 cut(s)	319
BmgT120I	GGNCC	1 cut(s)	319
BmiI	GGNNCC	2 cut(s)	234, 559
BmrFI	CCNGG	1 cut(s)	563
BmrI	ACTGGG	1 cut(s)	386
BmsI	GCATC	1 cut(s)	334
BmtI	GCTAGC	1 cut(s)	297
BmuI	ACTGGG	1 cut(s)	386
Bpu10I	CCTNAGC	1 cut(s)	474
BpuEI	CTTGAG	3 cut(s)	117, 220, 661
BpuMI	CCSGG	1 cut(s)	563
BsaI	GGTCTC	1 cut(s)	381
BsaJI	CCNNGG	2 cut(s)	462, 561
Bsc4I	CCNNNNNNNGG	2 cut(s)	398, 553
Bse1I	ACTGG	2 cut(s)	372, 392
BseDI	CCNNGG	2 cut(s)	462, 561
BseLI	CCNNNNNNNGG	2 cut(s)	398, 553
BseMII	CTCAG	2 cut(s)	243, 465
BseNI	ACTGG	2 cut(s)	372, 392
BseRI	GAGGAG	1 cut(s)	93
BseXI	GCAGC	2 cut(s)	172, 366
BsgI	GTGCAG	3 cut(s)	28, 234, 426
BshFI	GGCC	2 cut(s)	371, 461
BsiSI	CCGG	1 cut(s)	563
BslI	CCNNNNNNNGG	2 cut(s)	398, 553
BsmAI	GTCTC	1 cut(s)	381
BsmI	GAATGC	1 cut(s)	677
BsnI	GGCC	2 cut(s)	371, 461
Bso31I	GGTCTC	1 cut(s)	381
Bsp143I	GATC	6 cut(s)	195, 541, 557, 565, 580, 655
BspACI	CCGC	1 cut(s)	692
BspANI	GGCC	2 cut(s)	371, 461
BspCNI	CTCAG	2 cut(s)	244, 466
BspLI	GGNNCC	2 cut(s)	234, 559
BspOI	GCTAGC	1 cut(s)	297
BspPI	GGATC	3 cut(s)	552, 565, 573
BspTNI	GGTCTC	1 cut(s)	381
BsrI	ACTGG	2 cut(s)	372, 392
BssECI	CCNNGG	2 cut(s)	462, 561
BssMI	GATC	6 cut(s)	195, 541, 557, 565, 580, 655
BssT1I	CCWWGG	1 cut(s)	462
Bst4CI	ACNGT	1 cut(s)	127
Bst6I	CTCTTC	1 cut(s)	612
BstC8I	GCNNGC	5 cut(s)	190, 258, 295, 497, 501
BstDEI	CTNAG	2 cut(s)	252, 474
BstHHI	GCGC	1 cut(s)	677
BstKTI	GATC	6 cut(s)	198, 544, 560, 568, 583, 658
BstMAI	GTCTC	1 cut(s)	381
BstMBI	GATC	6 cut(s)	195, 541, 557, 565, 580, 655
BstMWI	GCNNNNNNNGC	4 cut(s)	458, 496, 642, 674
BstNSI	RCATGY	1 cut(s)	490
BstSCI	CCNGG	1 cut(s)	561
BstV1I	GCAGC	2 cut(s)	172, 366
BstX2I	RGATCY	2 cut(s)	195, 557
BstYI	RGATCY	2 cut(s)	195, 557
BsuRI	GGCC	2 cut(s)	371, 461
BtsI	GCAGTG	3 cut(s)	354, 497, 515
BtsIMutI	CAGTG	4 cut(s)	354, 379, 497, 515
Cac8I	GCNNGC	5 cut(s)	190, 258, 295, 497, 501
CfoI	GCGC	1 cut(s)	677
Cfr13I	GGNCC	1 cut(s)	319
Csp6I	GTAC	1 cut(s)	12
CviAII	CATG	4 cut(s)	358, 487, 523, 702
CviQI	GTAC	1 cut(s)	12
DdeI	CTNAG	2 cut(s)	252, 474
DpnI	GATC	6 cut(s)	197, 543, 559, 567, 582, 657
DpnII	GATC	6 cut(s)	195, 541, 557, 565, 580, 655
EaeI	YGGCCR	1 cut(s)	459
Eam1104I	CTCTTC	1 cut(s)	612
EarI	CTCTTC	1 cut(s)	612
Eco130I	CCWWGG	1 cut(s)	462
Eco31I	GGTCTC	1 cut(s)	381
Eco47I	GGWCC	1 cut(s)	319
EcoO109I	RGGNCCY	1 cut(s)	319
EcoT14I	CCWWGG	1 cut(s)	462
ErhI	CCWWGG	1 cut(s)	462
FaeI	CATG	4 cut(s)	361, 490, 526, 705
FalI	AAGNNNNNCTT	2 cut(s)	492, 524
FatI	CATG	4 cut(s)	357, 486, 522, 701
FbaI	TGATCA	1 cut(s)	655
Fnu4HI	GCNGC	2 cut(s)	186, 355
Fsp4HI	GCNGC	2 cut(s)	186, 355
FspBI	CTAG	3 cut(s)	21, 294, 671
GlaI	GCGC	1 cut(s)	676
GluI	GCNGC	2 cut(s)	186, 355
HaeIII	GGCC	2 cut(s)	371, 461
HapII	CCGG	1 cut(s)	563
HhaI	GCGC	1 cut(s)	677
Hin1II	CATG	4 cut(s)	361, 490, 526, 705
Hin6I	GCGC	1 cut(s)	675
HinP1I	GCGC	1 cut(s)	675
HincII	GTYRAC	1 cut(s)	484
HindII	GTYRAC	1 cut(s)	484
HinfI	GANTC	3 cut(s)	282, 329, 381
HpaII	CCGG	1 cut(s)	563
HphI	GGTGA	3 cut(s)	259, 536, 589
Hpy166II	GTNNAC	2 cut(s)	267, 484
Hpy188I	TCNGA	3 cut(s)	253, 386, 633
Hpy188III	TCNNGA	2 cut(s)	199, 326
Hpy8I	GTNNAC	2 cut(s)	267, 484
HpyAV	CCTTC	3 cut(s)	90, 332, 455
HpyCH4III	ACNGT	1 cut(s)	127
HpyCH4V	TGCA	8 cut(s)	9, 192, 215, 316, 347, 377, 407, 490
HpyF10VI	GCNNNNNNNGC	4 cut(s)	458, 496, 642, 674
HpyF3I	CTNAG	2 cut(s)	252, 474
Hsp92II	CATG	4 cut(s)	361, 490, 526, 705
HspAI	GCGC	1 cut(s)	675
Ksp22I	TGATCA	1 cut(s)	655
Kzo9I	GATC	6 cut(s)	195, 541, 557, 565, 580, 655
LmnI	GCTCC	1 cut(s)	238
Lsp1109I	GCAGC	2 cut(s)	172, 366
LweI	GCATC	1 cut(s)	334
MaeI	CTAG	3 cut(s)	21, 294, 671
MaeIII	GTNAC	2 cut(s)	127, 440
MalI	GATC	6 cut(s)	197, 543, 559, 567, 582, 657
MboI	GATC	6 cut(s)	195, 541, 557, 565, 580, 655
MboII	GAAGA	6 cut(s)	75, 78, 90, 216, 219, 599
MfeI	CAATTG	1 cut(s)	455
MflI	RGATCY	2 cut(s)	195, 557
MlsI	TGGCCA	1 cut(s)	461
MluCI	AATT	4 cut(s)	108, 147, 455, 686
MluNI	TGGCCA	1 cut(s)	461
MlyI	GAGTC	1 cut(s)	291
MmeI	TCCRAC	1 cut(s)	140
MnlI	CCTC	7 cut(s)	114, 255, 259, 361, 469, 615, 621
Mox20I	TGGCCA	1 cut(s)	461
MscI	TGGCCA	1 cut(s)	461
MseI	TTAA	1 cut(s)	27
MslI	CAYNNNNRTG	1 cut(s)	527
Msp20I	TGGCCA	1 cut(s)	461
MspI	CCGG	1 cut(s)	563
MspR9I	CCNGG	1 cut(s)	563
MunI	CAATTG	1 cut(s)	455
Mva1269I	GAATGC	1 cut(s)	677
MwoI	GCNNNNNNNGC	4 cut(s)	458, 496, 642, 674
NciI	CCSGG	1 cut(s)	563
NdeII	GATC	6 cut(s)	195, 541, 557, 565, 580, 655
NheI	GCTAGC	1 cut(s)	293
NlaIII	CATG	4 cut(s)	361, 490, 526, 705
NlaIV	GGNNCC	2 cut(s)	234, 559
NmuCI	GTSAC	1 cut(s)	440
NspI	RCATGY	1 cut(s)	490
PctI	GAATGC	1 cut(s)	677
PfeI	GAWTC	2 cut(s)	329, 381
PflFI	GACNNNGTC	1 cut(s)	392
PflMI	CCANNNNNTGG	1 cut(s)	398
PkrI	GCNGC	2 cut(s)	187, 356
PleI	GAGTC	1 cut(s)	290
PpsI	GAGTC	1 cut(s)	290
PpuMI	RGGWCCY	1 cut(s)	319
Psp5II	RGGWCCY	1 cut(s)	319
PspN4I	GGNNCC	2 cut(s)	234, 559
PspPI	GGNCC	1 cut(s)	319
PspPPI	RGGWCCY	1 cut(s)	319
PsuI	RGATCY	2 cut(s)	195, 557
PsyI	GACNNNGTC	1 cut(s)	392
RsaI	GTAC	1 cut(s)	13
RsaNI	GTAC	1 cut(s)	12
RseI	CAYNNNNRTG	1 cut(s)	527
SaqAI	TTAA	1 cut(s)	27
SatI	GCNGC	2 cut(s)	186, 355
Sau3AI	GATC	6 cut(s)	195, 541, 557, 565, 580, 655
Sau96I	GGNCC	1 cut(s)	319
ScaI	AGTACT	1 cut(s)	13
SchI	GAGTC	1 cut(s)	291
ScrFI	CCNGG	1 cut(s)	563
SetI	ASST	8 cut(s)	47, 139, 324, 447, 475, 480, 510, 647
SfaNI	GCATC	1 cut(s)	334
SinI	GGWCC	1 cut(s)	319
SmiMI	CAYNNNNRTG	1 cut(s)	527
SmlI	CTYRAG	3 cut(s)	132, 199, 640
SmoI	CTYRAG	3 cut(s)	132, 199, 640
Sse9I	AATT	4 cut(s)	108, 147, 455, 686
SsiI	CCGC	1 cut(s)	692
SspMI	CTAG	3 cut(s)	21, 294, 671
StyD4I	CCNGG	1 cut(s)	561
StyI	CCWWGG	1 cut(s)	462
TaaI	ACNGT	1 cut(s)	127
TaqI	TCGA	2 cut(s)	280, 579
TasI	AATT	4 cut(s)	108, 147, 455, 686
TatI	WGTACW	1 cut(s)	11
TfiI	GAWTC	2 cut(s)	329, 381
Tru1I	TTAA	1 cut(s)	27
Tru9I	TTAA	1 cut(s)	27
TscAI	CASTG	4 cut(s)	354, 379, 497, 522
TseFI	GTSAC	1 cut(s)	440
TseI	GCWGC	2 cut(s)	185, 354
Tsp45I	GTSAC	1 cut(s)	440
TspDTI	ATGAA	1 cut(s)	583
TspRI	CASTG	4 cut(s)	354, 379, 497, 522
Tth111I	GACNNNGTC	1 cut(s)	392
Van91I	CCANNNNNTGG	1 cut(s)	398
VpaK11BI	GGWCC	1 cut(s)	319
XapI	RAATTY	1 cut(s)	147
XceI	RCATGY	1 cut(s)	490
XspI	CTAG	3 cut(s)	21, 294, 671
ZrmI	AGTACT	1 cut(s)	13

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.