Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000469.1

Orthogroup ID

OG0004014

Physical Location & Seq

Genomic Coordinates Forward (+)

75709 .. 77080

Gene Structure 1372 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000469.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 606 bp

atgttgtttggttgttccagtggtatgcttgtccaagaccccaccagaggcgggggtgacgtggattcaattttcactcaagccagacagtttgcacaaggacctttggaaccttcgtcaagctcaaaaagttttactggaacagctagaacacttacaggagagaccgttccaactgctgcacctcagccacctgagtccatcaatcacaccattactttctggaggaatggcttttccatagatgacggtccgctgcggaggctggatgatcctgcaaatgcagccttcttggaaagcatcaagaagtctgagtgcccaaaagagcttgaaccagctagtaggaggaccactgttcatgtcagccttatgaagcgggaggaagactaccctgaaccattgaagcagcggggtcaggttgcttttcagggtgttggaagaacattaggtggcagcagctcggagtcagctgcctctgagtcaactgctgctgccagtcctcctcttacaactgctccattgccatcaatgggcttaactgttgatcagtcattgccgtcgacctctattcagctaaggttggctgatggtacccgattgagttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000096 GO:0000902 GO:0000904 GO:0002682 GO:0002683 GO:0003674 GO:0003676 GO:0003723 GO:0003727 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005739 GO:0005829 GO:0006082 GO:0006139 GO:0006520 GO:0006534 GO:0006555 GO:0006575 GO:0006725 GO:0006732 GO:0006790 GO:0006807 GO:0006950 GO:0006979 GO:0008150 GO:0008152 GO:0008187 GO:0008266 GO:0009058 GO:0009066 GO:0009069 GO:0009116 GO:0009119 GO:0009653 GO:0009759 GO:0009888 GO:0009966 GO:0009968 GO:0009987 GO:0010026 GO:0010090 GO:0010646 GO:0010648 GO:0016043 GO:0016143 GO:0016144 GO:0017144 GO:0018130 GO:0019222 GO:0019438 GO:0019748 GO:0019752 GO:0019757 GO:0019758 GO:0019760 GO:0019761 GO:0023051 GO:0023057 GO:0030154 GO:0031323 GO:0031347 GO:0031348 GO:0032502 GO:0032989 GO:0033353 GO:0034641 GO:0042278 GO:0042343 GO:0042430 GO:0042435 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0044237 GO:0044238 GO:0044249 GO:0044271 GO:0044272 GO:0044281 GO:0044424 GO:0044444 GO:0044464 GO:0044550 GO:0045088 GO:0045824 GO:0046128 GO:0046439 GO:0046483 GO:0046498 GO:0046500 GO:0048468 GO:0048519 GO:0048523 GO:0048583 GO:0048585 GO:0048856 GO:0048869 GO:0050776 GO:0050777 GO:0050789 GO:0050793 GO:0050794 GO:0050896 GO:0051186 GO:0055086 GO:0065007 GO:0071704 GO:0071840 GO:0072521 GO:0080134 GO:0080183 GO:0090342 GO:0090558 GO:0090626 GO:0097159 GO:1900457 GO:1900458 GO:1901135 GO:1901137 GO:1901360 GO:1901362 GO:1901363 GO:1901564 GO:1901566 GO:1901576 GO:1901605 GO:1901657 GO:1901659 GO:2000377

KEGG Pathways

Metabolic & Signaling

ko03015 ko04071 ko04113 ko04114 ko04151 ko04152 ko04261 ko04728 ko05165 map03015 map04071 map04113 map04114 map04151 map04152 map04261 map04728 map05165

Pfam Domains

Protein Families

B56

Protein Analysis

201

Amino Acids

21.29

Weight (kDa)

5.45

Isoelectric Point (pI)

60.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004014)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G05040 AT1G05040
fragaria_vesca	FvH4_6g42560
malus_domestica	MD09G1112600.v1.1 MD17G1102700.v1.1
prunus_persica	Prupe.3G212000_v2.0.a1
pyrus_communis	pycom09g03700 pycom17g09710
rosa_chinensis	RchiOBHm_Chr2g0158411
rosa_multiflora	Rmu_sc0000469.1_g000016 Rmu_sc0000469.1_g000017 Rmu_sc0004269.1_g000002 Rmu_sc0004855.1_g000011 Rmu_sc0008144.1_g000009 Rmu_sc0018496.1_g000001 Rmu_ssc0000482.1_g000001
rosa_roxburghii	Rroxscaffold_2G00091410 Rroxscaffold_2G00131060 Rroxscaffold_3G00232820 Rroxscaffold_5G00387420
rosa_rugosa	Rorug02G0468400
rosa_samantha	Rh2AG534600 Rh2BG548000 Rh2CG316000 Rh2CG349700 Rh2CG518400 Rh2DG557600 Rh4BG060900 Rh4CG066900
rosa_wichuraiana	Rw0G006730 Rw1G014520 Rw2G044270 Rw6G019090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	590
AccB1I	GGYRCC	1 cut(s)	590
AccI	GTMKAC	1 cut(s)	560
AciI	CCGC	5 cut(s)	51, 254, 259, 376, 409
AclWI	GGATC	1 cut(s)	266
AfaI	GTAC	1 cut(s)	592
AfiI	CCNNNNNNNGG	3 cut(s)	47, 51, 530
AgsI	TTSAA	3 cut(s)	69, 332, 403
AjiI	CACGTC	1 cut(s)	61
AloI	GAACNNNNNNTCC	2 cut(s)	153, 185
AluBI	AGCT	7 cut(s)	123, 146, 328, 338, 459, 470, 574
AluI	AGCT	7 cut(s)	123, 146, 328, 338, 459, 470, 574
Alw26I	GTCTC	1 cut(s)	158
AlwI	GGATC	1 cut(s)	266
ApeKI	GCWGC	9 cut(s)	179, 256, 284, 406, 453, 456, 470, 488, 491
Asp718I	GGTACC	1 cut(s)	590
AspS9I	GGNCC	3 cut(s)	101, 251, 348
AsuHPI	GGTGA	1 cut(s)	68
AvaII	GGWCC	3 cut(s)	101, 251, 348
BaeGI	GKGCMC	1 cut(s)	320
BanI	GGYRCC	1 cut(s)	590
BbsI	GAAGAC	1 cut(s)	390
BbvCI	CCTCAGC	1 cut(s)	186
BbvI	GCAGC	9 cut(s)	166, 243, 296, 418, 457, 465, 468, 475, 478
BccI	CCATC	3 cut(s)	209, 532, 581
BceAI	ACGGC	1 cut(s)	541
BclI	TGATCA	1 cut(s)	544
BcoDI	GTCTC	1 cut(s)	158
BfaI	CTAG	2 cut(s)	147, 339
BisI	GCNGC	9 cut(s)	180, 257, 285, 407, 454, 457, 471, 489, 492
BlsI	GCNGC	9 cut(s)	181, 258, 286, 408, 455, 458, 472, 490, 493
Bme18I	GGWCC	3 cut(s)	101, 251, 348
BmgBI	CACGTC	1 cut(s)	61
BmgT120I	GGNCC	3 cut(s)	101, 251, 348
BmiI	GGNNCC	2 cut(s)	111, 592
BmsI	GCATC	1 cut(s)	309
BpiI	GAAGAC	1 cut(s)	390
BpmI	CTGGAG	1 cut(s)	244
Bpu10I	CCTNAGC	2 cut(s)	186, 575
BpuEI	CTTGAG	1 cut(s)	63
BsaI	GGTCTC	1 cut(s)	158
BsaXI	ACNNNNNCTCC	4 cut(s)	153, 183, 499, 529
Bsc4I	CCNNNNNNNGG	3 cut(s)	47, 51, 530
Bse1I	ACTGG	3 cut(s)	18, 142, 495
Bse3DI	GCAATG	2 cut(s)	518, 551
BseGI	GGATG	1 cut(s)	274
BseLI	CCNNNNNNNGG	3 cut(s)	47, 51, 530
BseMI	GCAATG	2 cut(s)	518, 551
BseMII	CTCAG	4 cut(s)	186, 200, 303, 468
BseNI	ACTGG	3 cut(s)	18, 142, 495
BseRI	GAGGAG	1 cut(s)	492
BseSI	GKGCMC	1 cut(s)	320
BseXI	GCAGC	9 cut(s)	166, 243, 296, 418, 457, 465, 468, 475, 478
BsgI	GTGCAG	1 cut(s)	165
BshNI	GGYRCC	1 cut(s)	590
BslI	CCNNNNNNNGG	3 cut(s)	47, 51, 530
BsmAI	GTCTC	1 cut(s)	158
Bso31I	GGTCTC	1 cut(s)	158
Bsp1286I	GDGCHC	1 cut(s)	320
Bsp143I	GATC	2 cut(s)	271, 544
BspACI	CCGC	5 cut(s)	51, 254, 259, 376, 409
BspCNI	CTCAG	4 cut(s)	187, 199, 304, 469
BspLI	GGNNCC	2 cut(s)	111, 592
BspPI	GGATC	1 cut(s)	266
BspT107I	GGYRCC	1 cut(s)	590
BspTNI	GGTCTC	1 cut(s)	158
BsrDI	GCAATG	2 cut(s)	518, 551
BsrI	ACTGG	3 cut(s)	18, 142, 495
BssMI	GATC	2 cut(s)	271, 544
Bst4CI	ACNGT	5 cut(s)	90, 169, 251, 355, 541
BstDEI	CTNAG	5 cut(s)	186, 195, 312, 477, 575
BstF5I	GGATG	1 cut(s)	274
BstKTI	GATC	2 cut(s)	274, 547
BstMAI	GTCTC	1 cut(s)	158
BstMBI	GATC	2 cut(s)	271, 544
BstMWI	GCNNNNNNNGC	2 cut(s)	262, 284
BstSLI	GKGCMC	1 cut(s)	320
BstV1I	GCAGC	9 cut(s)	166, 243, 296, 418, 457, 465, 468, 475, 478
BstV2I	GAAGAC	1 cut(s)	390
BtrI	CACGTC	1 cut(s)	61
BtsCI	GGATG	1 cut(s)	274
BtsIMutI	CAGTG	2 cut(s)	25, 351
Cfr13I	GGNCC	3 cut(s)	101, 251, 348
CpoI	CGGWCCG	1 cut(s)	251
Csp6I	GTAC	1 cut(s)	591
CspI	CGGWCCG	1 cut(s)	251
CviAII	CATG	1 cut(s)	359
CviQI	GTAC	1 cut(s)	591
DdeI	CTNAG	5 cut(s)	186, 195, 312, 477, 575
DpnI	GATC	2 cut(s)	273, 546
DpnII	GATC	2 cut(s)	271, 544
Eco31I	GGTCTC	1 cut(s)	158
Eco47I	GGWCC	3 cut(s)	101, 251, 348
EcoO109I	RGGNCCY	1 cut(s)	101
FaeI	CATG	1 cut(s)	362
FaiI	YATR	4 cut(s)	26, 242, 360, 371
FatI	CATG	1 cut(s)	358
FauI	CCCGC	3 cut(s)	44, 369, 402
FbaI	TGATCA	1 cut(s)	544
FblI	GTMKAC	1 cut(s)	560
Fnu4HI	GCNGC	9 cut(s)	180, 257, 285, 407, 454, 457, 471, 489, 492
FokI	GGATG	1 cut(s)	281
Fsp4HI	GCNGC	9 cut(s)	180, 257, 285, 407, 454, 457, 471, 489, 492
FspBI	CTAG	2 cut(s)	147, 339
GluI	GCNGC	9 cut(s)	180, 257, 285, 407, 454, 457, 471, 489, 492
GsuI	CTGGAG	1 cut(s)	244
Hin1II	CATG	1 cut(s)	362
HincII	GTYRAC	2 cut(s)	483, 561
HindII	GTYRAC	2 cut(s)	483, 561
HinfI	GANTC	4 cut(s)	65, 197, 464, 479
HphI	GGTGA	1 cut(s)	68
Hpy166II	GTNNAC	2 cut(s)	483, 561
Hpy188I	TCNGA	3 cut(s)	313, 463, 478
Hpy188III	TCNNGA	2 cut(s)	223, 304
Hpy8I	GTNNAC	2 cut(s)	483, 561
Hpy99I	CGWCG	1 cut(s)	562
HpyAV	CCTTC	2 cut(s)	123, 298
HpyCH4III	ACNGT	5 cut(s)	90, 169, 251, 355, 541
HpyCH4IV	ACGT	1 cut(s)	60
HpyCH4V	TGCA	4 cut(s)	95, 182, 278, 284
HpyF10VI	GCNNNNNNNGC	2 cut(s)	262, 284
HpyF3I	CTNAG	5 cut(s)	186, 195, 312, 477, 575
HpySE526I	ACGT	1 cut(s)	60
Hsp92II	CATG	1 cut(s)	362
KpnI	GGTACC	1 cut(s)	594
Ksp22I	TGATCA	1 cut(s)	544
Kzo9I	GATC	2 cut(s)	271, 544
LmnI	GCTCC	1 cut(s)	520
Lsp1109I	GCAGC	9 cut(s)	166, 243, 296, 418, 457, 465, 468, 475, 478
LweI	GCATC	1 cut(s)	309
MaeI	CTAG	2 cut(s)	147, 339
MaeII	ACGT	1 cut(s)	60
MaeIII	GTNAC	1 cut(s)	56
MalI	GATC	2 cut(s)	273, 546
MboI	GATC	2 cut(s)	271, 544
MboII	GAAGA	2 cut(s)	395, 450
MhlI	GDGCHC	1 cut(s)	320
MluCI	AATT	1 cut(s)	69
MlyI	GAGTC	3 cut(s)	206, 473, 488
MmeI	TCCRAC	2 cut(s)	197, 415
MseI	TTAA	2 cut(s)	536, 604
MspA1I	CMGCKG	3 cut(s)	256, 409, 470
MwoI	GCNNNNNNNGC	2 cut(s)	262, 284
NdeII	GATC	2 cut(s)	271, 544
NlaIII	CATG	1 cut(s)	362
NlaIV	GGNNCC	2 cut(s)	111, 592
NmuCI	GTSAC	1 cut(s)	56
PfeI	GAWTC	1 cut(s)	65
PkrI	GCNGC	9 cut(s)	181, 258, 286, 408, 455, 458, 472, 490, 493
PleI	GAGTC	3 cut(s)	205, 472, 487
PpsI	GAGTC	3 cut(s)	205, 472, 487
PpuMI	RGGWCCY	1 cut(s)	101
Psp5II	RGGWCCY	1 cut(s)	101
PspN4I	GGNNCC	2 cut(s)	111, 592
PspPI	GGNCC	3 cut(s)	101, 251, 348
PspPPI	RGGWCCY	1 cut(s)	101
PvuII	CAGCTG	1 cut(s)	470
RsaI	GTAC	1 cut(s)	592
RsaNI	GTAC	1 cut(s)	591
Rsr2I	CGGWCCG	1 cut(s)	251
RsrII	CGGWCCG	1 cut(s)	251
SalI	GTCGAC	1 cut(s)	559
SaqAI	TTAA	2 cut(s)	536, 604
SatI	GCNGC	9 cut(s)	180, 257, 285, 407, 454, 457, 471, 489, 492
Sau3AI	GATC	2 cut(s)	271, 544
Sau96I	GGNCC	3 cut(s)	101, 251, 348
SchI	GAGTC	3 cut(s)	206, 473, 488
SduI	GDGCHC	1 cut(s)	320
SfaNI	GCATC	1 cut(s)	309
SinI	GGWCC	3 cut(s)	101, 251, 348
SmlI	CTYRAG	1 cut(s)	78
SmoI	CTYRAG	1 cut(s)	78
Sse9I	AATT	1 cut(s)	69
SsiI	CCGC	5 cut(s)	51, 254, 259, 376, 409
SspMI	CTAG	2 cut(s)	147, 339
TaaI	ACNGT	5 cut(s)	90, 169, 251, 355, 541
TaiI	ACGT	1 cut(s)	63
TaqI	TCGA	1 cut(s)	560
TasI	AATT	1 cut(s)	69
TfiI	GAWTC	1 cut(s)	65
Tru1I	TTAA	2 cut(s)	536, 604
Tru9I	TTAA	2 cut(s)	536, 604
TscAI	CASTG	2 cut(s)	25, 358
TseFI	GTSAC	1 cut(s)	56
TseI	GCWGC	9 cut(s)	179, 256, 284, 406, 453, 456, 470, 488, 491
Tsp45I	GTSAC	1 cut(s)	56
TspDTI	ATGAA	2 cut(s)	347, 386
TspRI	CASTG	2 cut(s)	25, 358
VpaK11BI	GGWCC	3 cut(s)	101, 251, 348
XmiI	GTMKAC	1 cut(s)	560
XspI	CTAG	2 cut(s)	147, 339

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.