Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000800.1

Orthogroup ID

OG0006960

Physical Location & Seq

Genomic Coordinates Reverse (-)

52954 .. 53573

Gene Structure 620 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000800.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 552 bp

atgggccgtgttttgggatcactagattctcactgtagtagcatgcctgcgagctggggatggatccatatagatcttcttgatgaaaatcccaattcgagacctatatcgatctgtcggacccctgcaaattcatctttccaatgttggagcaattgctcaagtttggagatggtgggtgttctgcttagagatttgaagcttggagatgatggtgttctgctttacattgatttggttgcaggaaagcagcgattagtgtttgagggagttcagggcctggttaatgatgaactggtctctggtggcgatgatattagtgatggtagacttctggtctatgccgttgagattgcatttgctgggaattgtggcattaatttggacgaaagtaccttctttcataagggagatatgggaggaagtgttggtggtagtggcggtgaggggggtgttgcagcagcctttggctgcaacgtgggtaatgatggtggtggcagtggtgaggatggggttgaagtgctgcagcgatggggaggagagaagagatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0003824 GO:0004642 GO:0005488 GO:0005524 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0007275 GO:0008144 GO:0008150 GO:0009507 GO:0009532 GO:0009536 GO:0009555 GO:0009570 GO:0016874 GO:0016879 GO:0016884 GO:0017076 GO:0030554 GO:0032501 GO:0032502 GO:0032553 GO:0032555 GO:0032559 GO:0035639 GO:0036094 GO:0043167 GO:0043168 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0048229 GO:0048856 GO:0055046 GO:0097159 GO:0097367 GO:1901265 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko00230 ko01100 ko01110 ko01130 map00230 map01100 map01110 map01130

Pfam Domains

Protein Families

AIRS_C GATase_5

Protein Analysis

183

Amino Acids

19.11

Weight (kDa)

4.4

Isoelectric Point (pI)

38.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006960)

Species	Orthologous Gene IDs
pyrus_communis	pycom02g00480 pycom13g19920
rosa_chinensis	RchiOBHm_Chr7g0229191
rosa_laevigata	RLG00000006185 RLG00000007431 RLG00000016147 RLG00000022439 RLG00000022857 RLG00000035073
rosa_multiflora	Rmu_sc0000014.1_g000037 Rmu_sc0000014.1_g000038 Rmu_sc0000800.1_g000015 Rmu_sc0001342.1_g000010 Rmu_sc0002983.1_g000064 Rmu_sc0008770.1_g000021 Rmu_sc0009252.1_g000009 Rmu_sc0009895.1_g000009 Rmu_sc0011973.1_g000004 Rmu_sc0014425.1_g000005 Rmu_ssc0000278.1_g000017
rosa_roxburghii	Rroxscaffold_2G00145630
rosa_samantha	Rh1AG324700 Rh2BG367500 Rh7AG407100 Rh7CG425300
rosa_wichuraiana	Rw7G004330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	328
AciI	CCGC	1 cut(s)	441
AclWI	GGATC	3 cut(s)	25, 58, 71
AcsI	RAATTY	1 cut(s)	130
AfaI	GTAC	1 cut(s)	394
AfiI	CCNNNNNNNGG	1 cut(s)	13
AgsI	TTSAA	2 cut(s)	199, 518
AhdI	GACNNNNNGTC	1 cut(s)	335
AjnI	CCWGG	1 cut(s)	279
AluBI	AGCT	2 cut(s)	54, 202
AluI	AGCT	2 cut(s)	54, 202
Alw26I	GTCTC	2 cut(s)	94, 304
AlwI	GGATC	3 cut(s)	25, 58, 71
AlwNI	CAGNNNCTG	1 cut(s)	280
AoxI	GGCC	2 cut(s)	4, 277
ApeKI	GCWGC	6 cut(s)	250, 458, 461, 471, 523, 526
ApoI	RAATTY	1 cut(s)	130
AseI	ATTAAT	1 cut(s)	378
AspS9I	GGNCC	3 cut(s)	4, 120, 277
AsuHPI	GGTGA	2 cut(s)	455, 515
AvaII	GGWCC	1 cut(s)	120
BaeI	ACNNNNGTAYC	2 cut(s)	376, 409
BamHI	GGATCC	1 cut(s)	63
BbvI	GCAGC	6 cut(s)	262, 458, 470, 473, 510, 538
BccI	CCATC	7 cut(s)	54, 166, 206, 317, 482, 503, 525
BceAI	ACGGC	1 cut(s)	329
BciT130I	CCWGG	1 cut(s)	281
BcoDI	GTCTC	2 cut(s)	94, 304
BfaI	CTAG	1 cut(s)	23
BfmI	CTRYAG	2 cut(s)	34, 524
BglII	AGATCT	1 cut(s)	73
BisI	GCNGC	6 cut(s)	251, 459, 462, 472, 524, 527
BlsI	GCNGC	6 cut(s)	252, 460, 463, 473, 525, 528
Bme1390I	CCNGG	1 cut(s)	281
Bme18I	GGWCC	1 cut(s)	120
BmeRI	GACNNNNNGTC	1 cut(s)	335
BmgT120I	GGNCC	3 cut(s)	4, 120, 277
BmiI	GGNNCC	2 cut(s)	65, 122
BmrFI	CCNGG	1 cut(s)	281
BpuEI	CTTGAG	1 cut(s)	145
Bsa29I	ATCGAT	1 cut(s)	110
BsaBI	GATNNNNATC	1 cut(s)	87
BsaI	GGTCTC	2 cut(s)	94, 304
BsaXI	ACNNNNNCTCC	2 cut(s)	411, 441
Bsc4I	CCNNNNNNNGG	1 cut(s)	13
Bse1I	ACTGG	1 cut(s)	300
Bse8I	GATNNNNATC	1 cut(s)	87
BseBI	CCWGG	1 cut(s)	281
BseCI	ATCGAT	1 cut(s)	110
BseGI	GGATG	2 cut(s)	65, 514
BseJI	GATNNNNATC	1 cut(s)	87
BseLI	CCNNNNNNNGG	1 cut(s)	13
BseNI	ACTGG	1 cut(s)	300
BseRI	GAGGAG	1 cut(s)	552
BseXI	GCAGC	6 cut(s)	262, 458, 470, 473, 510, 538
BseYI	CCCAGC	2 cut(s)	54, 362
BshFI	GGCC	2 cut(s)	6, 279
BshVI	ATCGAT	1 cut(s)	110
BslI	CCNNNNNNNGG	1 cut(s)	13
BsmAI	GTCTC	2 cut(s)	94, 304
BsnI	GGCC	2 cut(s)	6, 279
Bso31I	GGTCTC	2 cut(s)	94, 304
Bsp143I	GATC	4 cut(s)	17, 63, 73, 111
BspACI	CCGC	1 cut(s)	441
BspANI	GGCC	2 cut(s)	6, 279
BspDI	ATCGAT	1 cut(s)	110
BspLI	GGNNCC	2 cut(s)	65, 122
BspMAI	CTGCAG	1 cut(s)	528
BspPI	GGATC	3 cut(s)	25, 58, 71
BspTNI	GGTCTC	2 cut(s)	94, 304
BsrI	ACTGG	1 cut(s)	300
BssMI	GATC	4 cut(s)	17, 63, 73, 111
Bst2UI	CCWGG	1 cut(s)	281
Bst4CI	ACNGT	1 cut(s)	35
Bst6I	CTCTTC	1 cut(s)	539
BstC8I	GCNNGC	3 cut(s)	44, 48, 52
BstDEI	CTNAG	1 cut(s)	188
BstF5I	GGATG	2 cut(s)	65, 514
BstKTI	GATC	4 cut(s)	20, 66, 76, 114
BstMAI	GTCTC	2 cut(s)	94, 304
BstMBI	GATC	4 cut(s)	17, 63, 73, 111
BstNI	CCWGG	1 cut(s)	281
BstNSI	RCATGY	1 cut(s)	46
BstSCI	CCNGG	1 cut(s)	279
BstSFI	CTRYAG	2 cut(s)	34, 524
BstV1I	GCAGC	6 cut(s)	262, 458, 470, 473, 510, 538
BstX2I	RGATCY	2 cut(s)	63, 73
BstYI	RGATCY	2 cut(s)	63, 73
Bsu15I	ATCGAT	1 cut(s)	110
BsuRI	GGCC	2 cut(s)	6, 279
BsuTUI	ATCGAT	1 cut(s)	110
BtgZI	GCGATG	2 cut(s)	324, 544
BtsCI	GGATG	2 cut(s)	65, 514
BtsI	GCAGTG	1 cut(s)	505
BtsIMutI	CAGTG	2 cut(s)	31, 505
Cac8I	GCNNGC	3 cut(s)	44, 48, 52
CaiI	CAGNNNCTG	1 cut(s)	280
Cfr13I	GGNCC	3 cut(s)	4, 120, 277
ClaI	ATCGAT	1 cut(s)	110
Csp6I	GTAC	1 cut(s)	393
CviAII	CATG	1 cut(s)	43
CviJI	RGCY	6 cut(s)	6, 54, 202, 279, 464, 471
CviKI_1	RGCY	6 cut(s)	6, 54, 202, 279, 464, 471
CviQI	GTAC	1 cut(s)	393
DdeI	CTNAG	1 cut(s)	188
DpnI	GATC	4 cut(s)	19, 65, 75, 113
DpnII	GATC	4 cut(s)	17, 63, 73, 111
DriI	GACNNNNNGTC	1 cut(s)	335
Eam1104I	CTCTTC	1 cut(s)	539
Eam1105I	GACNNNNNGTC	1 cut(s)	335
EarI	CTCTTC	1 cut(s)	539
Eco31I	GGTCTC	2 cut(s)	94, 304
Eco47I	GGWCC	1 cut(s)	120
EcoO109I	RGGNCCY	1 cut(s)	277
EcoRII	CCWGG	1 cut(s)	279
FaeI	CATG	1 cut(s)	46
FaiI	YATR	7 cut(s)	44, 69, 71, 107, 342, 405, 416
FatI	CATG	1 cut(s)	42
FblI	GTMKAC	1 cut(s)	328
Fnu4HI	GCNGC	6 cut(s)	251, 459, 462, 472, 524, 527
FokI	GGATG	2 cut(s)	72, 521
Fsp4HI	GCNGC	6 cut(s)	251, 459, 462, 472, 524, 527
FspBI	CTAG	1 cut(s)	23
GluI	GCNGC	6 cut(s)	251, 459, 462, 472, 524, 527
GsaI	CCCAGC	2 cut(s)	58, 366
HaeIII	GGCC	2 cut(s)	6, 279
Hin1II	CATG	1 cut(s)	46
HindIII	AAGCTT	1 cut(s)	200
HinfI	GANTC	1 cut(s)	26
HphI	GGTGA	2 cut(s)	455, 515
Hpy166II	GTNNAC	1 cut(s)	329
Hpy188I	TCNGA	1 cut(s)	120
Hpy188III	TCNNGA	2 cut(s)	80, 99
Hpy8I	GTNNAC	1 cut(s)	329
HpyAV	CCTTC	1 cut(s)	406
HpyCH4III	ACNGT	1 cut(s)	35
HpyCH4IV	ACGT	1 cut(s)	477
HpyCH4V	TGCA	6 cut(s)	128, 242, 356, 458, 474, 526
HpyF3I	CTNAG	1 cut(s)	188
HpySE526I	ACGT	1 cut(s)	477
Hsp92II	CATG	1 cut(s)	46
Kzo9I	GATC	4 cut(s)	17, 63, 73, 111
LmnI	GCTCC	1 cut(s)	150
Lsp1109I	GCAGC	6 cut(s)	262, 458, 470, 473, 510, 538
MaeI	CTAG	1 cut(s)	23
MaeII	ACGT	1 cut(s)	477
MalI	GATC	4 cut(s)	19, 65, 75, 113
MboI	GATC	4 cut(s)	17, 63, 73, 111
MboII	GAAGA	1 cut(s)	68
MfeI	CAATTG	1 cut(s)	154
MflI	RGATCY	2 cut(s)	63, 73
MluCI	AATT	5 cut(s)	94, 130, 154, 367, 379
MmeI	TCCRAC	2 cut(s)	98, 128
MnlI	CCTC	5 cut(s)	259, 413, 439, 499, 530
MseI	TTAA	2 cut(s)	285, 378
MspR9I	CCNGG	1 cut(s)	281
MunI	CAATTG	1 cut(s)	154
MvaI	CCWGG	1 cut(s)	281
NdeII	GATC	4 cut(s)	17, 63, 73, 111
NlaIII	CATG	1 cut(s)	46
NlaIV	GGNNCC	2 cut(s)	65, 122
NspI	RCATGY	1 cut(s)	46
PaeI	GCATGC	1 cut(s)	46
PfeI	GAWTC	1 cut(s)	26
PkrI	GCNGC	6 cut(s)	252, 460, 463, 473, 525, 528
PshBI	ATTAAT	1 cut(s)	378
Psp6I	CCWGG	1 cut(s)	279
PspFI	CCCAGC	2 cut(s)	54, 362
PspGI	CCWGG	1 cut(s)	279
PspN4I	GGNNCC	2 cut(s)	65, 122
PspPI	GGNCC	3 cut(s)	4, 120, 277
PstI	CTGCAG	1 cut(s)	528
PstNI	CAGNNNCTG	1 cut(s)	280
PsuI	RGATCY	2 cut(s)	63, 73
RsaI	GTAC	1 cut(s)	394
RsaNI	GTAC	1 cut(s)	393
SaqAI	TTAA	2 cut(s)	285, 378
SatI	GCNGC	6 cut(s)	251, 459, 462, 472, 524, 527
Sau3AI	GATC	4 cut(s)	17, 63, 73, 111
Sau96I	GGNCC	3 cut(s)	4, 120, 277
ScrFI	CCNGG	1 cut(s)	281
SetI	ASST	5 cut(s)	56, 106, 204, 398, 480
SfcI	CTRYAG	2 cut(s)	34, 524
SinI	GGWCC	1 cut(s)	120
SmlI	CTYRAG	1 cut(s)	160
SmoI	CTYRAG	1 cut(s)	160
SphI	GCATGC	1 cut(s)	46
Sse9I	AATT	5 cut(s)	94, 130, 154, 367, 379
SsiI	CCGC	1 cut(s)	441
SspMI	CTAG	1 cut(s)	23
StyD4I	CCNGG	1 cut(s)	279
TaaI	ACNGT	1 cut(s)	35
TaiI	ACGT	1 cut(s)	480
TaqI	TCGA	2 cut(s)	98, 110
TasI	AATT	5 cut(s)	94, 130, 154, 367, 379
TfiI	GAWTC	1 cut(s)	26
Tru1I	TTAA	2 cut(s)	285, 378
Tru9I	TTAA	2 cut(s)	285, 378
TscAI	CASTG	2 cut(s)	38, 505
TseI	GCWGC	6 cut(s)	250, 458, 461, 471, 523, 526
TspDTI	ATGAA	4 cut(s)	99, 123, 306, 392
TspRI	CASTG	2 cut(s)	38, 505
VpaK11BI	GGWCC	1 cut(s)	120
VspI	ATTAAT	1 cut(s)	378
XapI	RAATTY	1 cut(s)	130
XceI	RCATGY	1 cut(s)	46
XmiI	GTMKAC	1 cut(s)	328
XspI	CTAG	1 cut(s)	23

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.