Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009895.1

Orthogroup ID

OG0006960

Physical Location & Seq

Genomic Coordinates Forward (+)

25087 .. 25763

Gene Structure 677 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009895.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 591 bp

atgggccgtgttttgggatcactagattcgcacggtggtagcgtgcctgcgagctggggatggatccatatcgatcttcttgatgaaaatcccagatcgagacctatatcgatctgtcggacccctgcaaattcatctttccaatgttggagtaattgctcaggcttggagatggtgggtgttctgcttagaggtttgaagcttggagatgatggtgttctgctttacattgatttgcgagtgtttgagggagttcagggccttcttaatgatcaattggtctctggtggccatgatattagtgatggtagacttctggtctatgccgttgagattgcacttgttgggaattgtggcattaatttggacgaaagtaccttctttcataagggacatatgggaggaagtattggtggtagtggcggtgaggagggtgttgcagcagcctttggctgcaacgtgggtaatgatggtggtggaagtggtgaggatgggttgaagtgttgcagcgatggggaggggagaagagatgaacagaaaaaaaagaaaagaaagaataaattgaaaaagaaaaaagaaaaaattacttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0003824 GO:0004642 GO:0005488 GO:0005524 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0007275 GO:0008144 GO:0008150 GO:0009507 GO:0009532 GO:0009536 GO:0009555 GO:0009570 GO:0016874 GO:0016879 GO:0016884 GO:0017076 GO:0030554 GO:0032501 GO:0032502 GO:0032553 GO:0032555 GO:0032559 GO:0035639 GO:0036094 GO:0043167 GO:0043168 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0048229 GO:0048856 GO:0055046 GO:0097159 GO:0097367 GO:1901265 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko00230 ko01100 ko01110 ko01130 map00230 map01100 map01110 map01130

Pfam Domains

Protein Families

AIRS_C GATase_5

Protein Analysis

196

Amino Acids

20.77

Weight (kDa)

6.51

Isoelectric Point (pI)

34.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006960)

Species	Orthologous Gene IDs
pyrus_communis	pycom02g00480 pycom13g19920
rosa_chinensis	RchiOBHm_Chr7g0229191
rosa_laevigata	RLG00000006185 RLG00000007431 RLG00000016147 RLG00000022439 RLG00000022857 RLG00000035073
rosa_multiflora	Rmu_sc0000014.1_g000037 Rmu_sc0000014.1_g000038 Rmu_sc0000800.1_g000015 Rmu_sc0001342.1_g000010 Rmu_sc0002983.1_g000064 Rmu_sc0008770.1_g000021 Rmu_sc0009252.1_g000009 Rmu_sc0009895.1_g000009 Rmu_sc0011973.1_g000004 Rmu_sc0014425.1_g000005 Rmu_ssc0000278.1_g000017
rosa_roxburghii	Rroxscaffold_2G00145630
rosa_samantha	Rh1AG324700 Rh2BG367500 Rh7AG407100 Rh7CG425300
rosa_wichuraiana	Rw7G004330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	310
AciI	CCGC	1 cut(s)	423
AclWI	GGATC	3 cut(s)	25, 58, 71
AcoI	YGGCCR	1 cut(s)	289
AcsI	RAATTY	1 cut(s)	130
AfaI	GTAC	1 cut(s)	376
AfiI	CCNNNNNNNGG	1 cut(s)	13
AgsI	TTSAA	3 cut(s)	199, 499, 565
AhdI	GACNNNNNGTC	1 cut(s)	317
AluBI	AGCT	2 cut(s)	54, 202
AluI	AGCT	2 cut(s)	54, 202
Alw26I	GTCTC	2 cut(s)	94, 286
AlwI	GGATC	3 cut(s)	25, 58, 71
AoxI	GGCC	3 cut(s)	4, 259, 289
ApeKI	GCWGC	4 cut(s)	440, 443, 453, 507
ApoI	RAATTY	1 cut(s)	130
AseI	ATTAAT	1 cut(s)	360
AspS9I	GGNCC	3 cut(s)	4, 120, 259
AsuHPI	GGTGA	2 cut(s)	437, 497
AvaII	GGWCC	1 cut(s)	120
BaeI	ACNNNNGTAYC	2 cut(s)	358, 391
BalI	TGGCCA	1 cut(s)	291
BamHI	GGATCC	1 cut(s)	63
BbvI	GCAGC	4 cut(s)	440, 452, 455, 519
BccI	CCATC	7 cut(s)	54, 166, 206, 299, 464, 485, 506
BceAI	ACGGC	1 cut(s)	311
BclI	TGATCA	1 cut(s)	271
BcoDI	GTCTC	2 cut(s)	94, 286
BfaI	CTAG	1 cut(s)	23
BisI	GCNGC	4 cut(s)	441, 444, 454, 508
BlsI	GCNGC	4 cut(s)	442, 445, 455, 509
Bme18I	GGWCC	1 cut(s)	120
BmeRI	GACNNNNNGTC	1 cut(s)	317
BmgT120I	GGNCC	3 cut(s)	4, 120, 259
BmiI	GGNNCC	2 cut(s)	65, 122
Bpu10I	CCTNAGC	1 cut(s)	160
Bsa29I	ATCGAT	2 cut(s)	72, 110
BsaBI	GATNNNNATC	2 cut(s)	68, 87
BsaI	GGTCTC	2 cut(s)	94, 286
Bsc4I	CCNNNNNNNGG	1 cut(s)	13
Bse8I	GATNNNNATC	2 cut(s)	68, 87
BseCI	ATCGAT	2 cut(s)	72, 110
BseGI	GGATG	2 cut(s)	65, 496
BseJI	GATNNNNATC	2 cut(s)	68, 87
BseLI	CCNNNNNNNGG	1 cut(s)	13
BseMII	CTCAG	1 cut(s)	174
BseRI	GAGGAG	1 cut(s)	443
BseXI	GCAGC	4 cut(s)	440, 452, 455, 519
BseYI	CCCAGC	1 cut(s)	54
BshFI	GGCC	3 cut(s)	6, 261, 291
BshVI	ATCGAT	2 cut(s)	72, 110
BslFI	GGGAC	1 cut(s)	405
BslI	CCNNNNNNNGG	1 cut(s)	13
BsmAI	GTCTC	2 cut(s)	94, 286
BsmFI	GGGAC	1 cut(s)	405
BsnI	GGCC	3 cut(s)	6, 261, 291
Bso31I	GGTCTC	2 cut(s)	94, 286
Bsp143I	GATC	6 cut(s)	17, 63, 73, 95, 111, 271
BspACI	CCGC	1 cut(s)	423
BspANI	GGCC	3 cut(s)	6, 261, 291
BspCNI	CTCAG	1 cut(s)	173
BspDI	ATCGAT	2 cut(s)	72, 110
BspLI	GGNNCC	2 cut(s)	65, 122
BspPI	GGATC	3 cut(s)	25, 58, 71
BspTNI	GGTCTC	2 cut(s)	94, 286
BssMI	GATC	6 cut(s)	17, 63, 73, 95, 111, 271
Bst4CI	ACNGT	1 cut(s)	35
Bst6I	CTCTTC	1 cut(s)	520
BstC8I	GCNNGC	3 cut(s)	44, 48, 52
BstDEI	CTNAG	2 cut(s)	160, 188
BstF5I	GGATG	2 cut(s)	65, 496
BstKTI	GATC	6 cut(s)	20, 66, 76, 98, 114, 274
BstMAI	GTCTC	2 cut(s)	94, 286
BstMBI	GATC	6 cut(s)	17, 63, 73, 95, 111, 271
BstV1I	GCAGC	4 cut(s)	440, 452, 455, 519
BstX2I	RGATCY	1 cut(s)	63
BstYI	RGATCY	1 cut(s)	63
Bsu15I	ATCGAT	2 cut(s)	72, 110
BsuRI	GGCC	3 cut(s)	6, 261, 291
BsuTUI	ATCGAT	2 cut(s)	72, 110
BtgZI	GCGATG	1 cut(s)	525
BtsCI	GGATG	2 cut(s)	65, 496
Cac8I	GCNNGC	3 cut(s)	44, 48, 52
Cfr13I	GGNCC	3 cut(s)	4, 120, 259
ClaI	ATCGAT	2 cut(s)	72, 110
Csp6I	GTAC	1 cut(s)	375
CviAII	CATG	1 cut(s)	293
CviJI	RGCY	8 cut(s)	6, 54, 165, 202, 261, 291, 446, 453
CviKI_1	RGCY	8 cut(s)	6, 54, 165, 202, 261, 291, 446, 453
CviQI	GTAC	1 cut(s)	375
DdeI	CTNAG	2 cut(s)	160, 188
DpnI	GATC	6 cut(s)	19, 65, 75, 97, 113, 273
DpnII	GATC	6 cut(s)	17, 63, 73, 95, 111, 271
DriI	GACNNNNNGTC	1 cut(s)	317
EaeI	YGGCCR	1 cut(s)	289
Eam1104I	CTCTTC	1 cut(s)	520
Eam1105I	GACNNNNNGTC	1 cut(s)	317
EarI	CTCTTC	1 cut(s)	520
Eco31I	GGTCTC	2 cut(s)	94, 286
Eco47I	GGWCC	1 cut(s)	120
EcoO109I	RGGNCCY	1 cut(s)	259
FaeI	CATG	1 cut(s)	296
FaiI	YATR	7 cut(s)	69, 107, 294, 324, 387, 396, 398
FaqI	GGGAC	1 cut(s)	405
FatI	CATG	1 cut(s)	292
FauNDI	CATATG	1 cut(s)	396
FbaI	TGATCA	1 cut(s)	271
FblI	GTMKAC	1 cut(s)	310
Fnu4HI	GCNGC	4 cut(s)	441, 444, 454, 508
FokI	GGATG	2 cut(s)	72, 503
Fsp4HI	GCNGC	4 cut(s)	441, 444, 454, 508
FspBI	CTAG	1 cut(s)	23
GluI	GCNGC	4 cut(s)	441, 444, 454, 508
GsaI	CCCAGC	1 cut(s)	58
HaeIII	GGCC	3 cut(s)	6, 261, 291
Hin1II	CATG	1 cut(s)	296
HindIII	AAGCTT	1 cut(s)	200
HinfI	GANTC	1 cut(s)	26
HphI	GGTGA	2 cut(s)	437, 497
Hpy166II	GTNNAC	1 cut(s)	311
Hpy188I	TCNGA	1 cut(s)	120
Hpy188III	TCNNGA	2 cut(s)	80, 99
Hpy8I	GTNNAC	1 cut(s)	311
HpyAV	CCTTC	2 cut(s)	272, 388
HpyCH4III	ACNGT	1 cut(s)	35
HpyCH4IV	ACGT	1 cut(s)	459
HpyCH4V	TGCA	5 cut(s)	128, 338, 440, 456, 507
HpyF3I	CTNAG	2 cut(s)	160, 188
HpySE526I	ACGT	1 cut(s)	459
Hsp92II	CATG	1 cut(s)	296
Ksp22I	TGATCA	1 cut(s)	271
Kzo9I	GATC	6 cut(s)	17, 63, 73, 95, 111, 271
LpnPI	CCDG	8 cut(s)	40, 60, 106, 138, 147, 242, 270, 302
Lsp1109I	GCAGC	4 cut(s)	440, 452, 455, 519
MaeI	CTAG	1 cut(s)	23
MaeII	ACGT	1 cut(s)	459
MalI	GATC	6 cut(s)	19, 65, 75, 97, 113, 273
MboI	GATC	6 cut(s)	17, 63, 73, 95, 111, 271
MboII	GAAGA	2 cut(s)	68, 537
MfeI	CAATTG	1 cut(s)	275
MflI	RGATCY	1 cut(s)	63
MlsI	TGGCCA	1 cut(s)	291
MluCI	AATT	7 cut(s)	130, 154, 275, 349, 361, 560, 582
MluNI	TGGCCA	1 cut(s)	291
MmeI	TCCRAC	2 cut(s)	98, 128
MnlI	CCTC	7 cut(s)	185, 241, 395, 421, 424, 481, 511
Mox20I	TGGCCA	1 cut(s)	291
MscI	TGGCCA	1 cut(s)	291
MseI	TTAA	3 cut(s)	267, 360, 589
Msp20I	TGGCCA	1 cut(s)	291
MunI	CAATTG	1 cut(s)	275
NdeI	CATATG	1 cut(s)	396
NdeII	GATC	6 cut(s)	17, 63, 73, 95, 111, 271
NlaIII	CATG	1 cut(s)	296
NlaIV	GGNNCC	2 cut(s)	65, 122
PcsI	WCGNNNNNNNCGW	1 cut(s)	39
PfeI	GAWTC	1 cut(s)	26
PkrI	GCNGC	4 cut(s)	442, 445, 455, 509
PshBI	ATTAAT	1 cut(s)	360
PspFI	CCCAGC	1 cut(s)	54
PspN4I	GGNNCC	2 cut(s)	65, 122
PspPI	GGNCC	3 cut(s)	4, 120, 259
PsuI	RGATCY	1 cut(s)	63
RsaI	GTAC	1 cut(s)	376
RsaNI	GTAC	1 cut(s)	375
SaqAI	TTAA	3 cut(s)	267, 360, 589
SatI	GCNGC	4 cut(s)	441, 444, 454, 508
Sau3AI	GATC	6 cut(s)	17, 63, 73, 95, 111, 271
Sau96I	GGNCC	3 cut(s)	4, 120, 259
SetI	ASST	6 cut(s)	56, 106, 196, 204, 380, 462
SinI	GGWCC	1 cut(s)	120
Sse9I	AATT	7 cut(s)	130, 154, 275, 349, 361, 560, 582
SsiI	CCGC	1 cut(s)	423
SspMI	CTAG	1 cut(s)	23
TaaI	ACNGT	1 cut(s)	35
TaiI	ACGT	1 cut(s)	462
TaqI	TCGA	3 cut(s)	72, 98, 110
TasI	AATT	7 cut(s)	130, 154, 275, 349, 361, 560, 582
TfiI	GAWTC	1 cut(s)	26
Tru1I	TTAA	3 cut(s)	267, 360, 589
Tru9I	TTAA	3 cut(s)	267, 360, 589
TseI	GCWGC	4 cut(s)	440, 443, 453, 507
TspDTI	ATGAA	4 cut(s)	99, 123, 374, 546
VpaK11BI	GGWCC	1 cut(s)	120
VspI	ATTAAT	1 cut(s)	360
XapI	RAATTY	1 cut(s)	130
XmiI	GTMKAC	1 cut(s)	310
XspI	CTAG	1 cut(s)	23

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.