Rmu_sc0000837.1_g000011

Transcription factor VOZ1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000837.1
OG0001263
Physical Location & Seq
Forward (+)
38856 .. 47414
8559 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000837.1_g000011.1.cds

Sequence Viewer

Length: 1419 bp
atgatcctaccagcggttaagttaggaacccttgccctgaaaaccttctgcaaacccattgccaatcgcctcaagaaagaggctggcttgcaccccaggtttaggcagttcatcatcaacattgcccaggcaaatcatcgatttacaacaaatgtgcaaagacggatttatggtcattcaactgatgttgcgattcgtccactgaacgaggagaaagctgtccaagctgctgcagaacttcttggggagctctttgtgttcacggttgcagggactgcacttatttttgaagtccaaagaagttcaagatcagaagcaagaaaggaggagctgcgtaaacaggagttacaggaggatgatgcaacaagtccattaaaggaattgctacctactaagccagagagtgatcttcaaaaccttcatttgggtaatttggtgcaatttacagaggatttttatgtttctccggagcctcgagagcctcaagaaacttttcaagaattttatcaatgcggagatactgcttcaggtttccagaatctaatggtcgataactctggttttgatcatcactttgattttcatcaatatgtcaatgaagggccattccttggggggaacgatgtgaaacagcctgaagagcatgctgcgccaagtgttttgccagttatctctcctgcagaaccttcttttttggggccaacatgtgctctttgggattgttccaggcctgtggaatgtggaaaggactattgctgtaactttcatgctacatcagcattagaagagggtcaacctggaaaatctccagtttttcgtcctcgtggcatttcgttaaaggataatgcactttttgatgcactaattgcttggaatcagggaaaagctgtgggcatacccaattgtgaaggggcagctactctaaaatctccatggaatgactctaagctattcaatctttctttccttgagggtgaaacagttagagagtggctcttttttgataagcctagaagggcctttgggactggaaacagaaggcagaggtcattgccagatcacagtggacgtggttggcatgaatcaagaaagcagatcatgaaggaatttgatgggcagaaaaggtcctattatatggatccacagccctcaattgatcaggactggcatttgtttgaatatgaggtcaacaattctgatgcctgtgctctatataggttggagttaaagtttggcattgtaaagaaaagtccaaaaggaaaagtatcaaatgaggttgctgatctgcaaaagaagatgggaaagctcactgctgaggttgccactgatggtgcaaacaatgccaaagggaaaactaagaaaaaggctgatgctggcaatattttttcttctcaaagtccgatgacttcaactccctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

472

Amino Acids

52.93

Weight (kDa)

6.66

Isoelectric Point (pI)

50.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 611
AccIII TCCGGA 1 cut(s) 466
AciI CCGC 2 cut(s) 14, 513
AclWI GGATC 2 cut(s) 1133, 1146
AcsI RAATTY 2 cut(s) 500, 1106
AcuI CTGAAG 2 cut(s) 510, 657
AfiI CCNNNNNNNGG 4 cut(s) 13, 102, 424, 611
AflIII ACRYGT 1 cut(s) 704
AgsI TTSAA 8 cut(s) 180, 290, 306, 413, 497, 955, 1178, 1410
AjiI CACGTC 1 cut(s) 1070
AjnI CCWGG 4 cut(s) 95, 126, 725, 796
AluBI AGCT 8 cut(s) 218, 227, 250, 331, 887, 917, 949, 1306
AluI AGCT 8 cut(s) 218, 227, 250, 331, 887, 917, 949, 1306
Alw21I GWGCWC 3 cut(s) 252, 712, 1210
AlwI GGATC 2 cut(s) 1133, 1146
AlwNI CAGNNNCTG 1 cut(s) 275
Ama87I CYCGRG 1 cut(s) 474
Aor13HI TCCGGA 1 cut(s) 466
AoxI GGCC 4 cut(s) 602, 698, 728, 1017
ApeKI GCWGC 5 cut(s) 227, 230, 331, 647, 914
ApoI RAATTY 2 cut(s) 500, 1106
Asp700I GAANNNNTTC 2 cut(s) 44, 492
AspLEI GCGC 1 cut(s) 652
AspS9I GGNCC 4 cut(s) 602, 698, 1017, 1125
AsuHPI GGTGA 1 cut(s) 986
AvaI CYCGRG 1 cut(s) 474
AvaII GGWCC 1 cut(s) 1125
BamHI GGATCC 1 cut(s) 1138
BanII GRGCYC 1 cut(s) 252
BauI CACGAG 1 cut(s) 822
Bbv12I GWGCWC 3 cut(s) 252, 712, 1210
BbvCI CCTCAGC 1 cut(s) 1314
BbvI GCAGC 5 cut(s) 214, 217, 318, 634, 926
BccI CCATC 3 cut(s) 1106, 1291, 1322
BciT130I CCWGG 4 cut(s) 97, 128, 727, 798
BclI TGATCA 2 cut(s) 565, 1156
BfaI CTAG 1 cut(s) 1011
BfmI CTRYAG 2 cut(s) 231, 678
BisI GCNGC 5 cut(s) 228, 231, 332, 648, 915
BlsI GCNGC 5 cut(s) 229, 232, 333, 649, 916
Bme1390I CCNGG 4 cut(s) 97, 128, 727, 798
Bme18I GGWCC 1 cut(s) 1125
BmeT110I CYCGRG 1 cut(s) 474
BmgBI CACGTC 1 cut(s) 1070
BmgT120I GGNCC 4 cut(s) 602, 698, 1017, 1125
BmiI GGNNCC 4 cut(s) 28, 471, 699, 1140
BmrFI CCNGG 4 cut(s) 97, 128, 727, 798
BmsI GCATC 4 cut(s) 349, 847, 1189, 1360
BplI GAGNNNNNCTC 2 cut(s) 978, 1010
BpmI CTGGAG 1 cut(s) 792
Bpu10I CCTNAGC 1 cut(s) 1314
BpuEI CTTGAG 3 cut(s) 56, 468, 989
Bsa29I ATCGAT 1 cut(s) 139
BsaBI GATNNNNATC 1 cut(s) 582
BsaJI CCNNGG 4 cut(s) 95, 126, 610, 932
BsaWI WCCGGW 1 cut(s) 466
BsaXI ACNNNNNCTCC 3 cut(s) 1214, 1244, 1396
Bsc4I CCNNNNNNNGG 4 cut(s) 13, 102, 424, 611
Bse1I ACTGG 4 cut(s) 665, 809, 1033, 1169
Bse3DI GCAATG 3 cut(s) 57, 120, 1049
Bse8I GATNNNNATC 1 cut(s) 582
BseAI TCCGGA 1 cut(s) 466
BseBI CCWGG 4 cut(s) 97, 128, 727, 798
BseCI ATCGAT 1 cut(s) 139
BseDI CCNNGG 4 cut(s) 95, 126, 610, 932
BseGI GGATG 1 cut(s) 361
BseJI GATNNNNATC 1 cut(s) 582
BseLI CCNNNNNNNGG 4 cut(s) 13, 102, 424, 611
BseMI GCAATG 3 cut(s) 57, 120, 1049
BseMII CTCAG 1 cut(s) 1305
BseNI ACTGG 4 cut(s) 665, 809, 1033, 1169
BseRI GAGGAG 2 cut(s) 224, 341
BseXI GCAGC 5 cut(s) 214, 217, 318, 634, 926
BsgI GTGCAG 1 cut(s) 261
BshFI GGCC 4 cut(s) 604, 700, 730, 1019
BshVI ATCGAT 1 cut(s) 139
BsiHKAI GWGCWC 3 cut(s) 252, 712, 1210
BsiHKCI CYCGRG 1 cut(s) 474
BsiSI CCGG 1 cut(s) 467
BslFI GGGAC 2 cut(s) 286, 1039
BslI CCNNNNNNNGG 4 cut(s) 13, 102, 424, 611
BsmFI GGGAC 2 cut(s) 286, 1039
BsnI GGCC 4 cut(s) 604, 700, 730, 1019
BsoBI CYCGRG 1 cut(s) 474
Bsp1286I GDGCHC 3 cut(s) 252, 712, 1210
Bsp13I TCCGGA 1 cut(s) 466
Bsp143I GATC 9 cut(s) 3, 308, 406, 565, 1057, 1095, 1138, 1156, 1282
Bsp19I CCATGG 1 cut(s) 932
BspACI CCGC 2 cut(s) 14, 513
BspANI GGCC 4 cut(s) 604, 700, 730, 1019
BspCNI CTCAG 1 cut(s) 1306
BspDI ATCGAT 1 cut(s) 139
BspEI TCCGGA 1 cut(s) 466
BspHI TCATGA 1 cut(s) 1098
BspLI GGNNCC 4 cut(s) 28, 471, 699, 1140
BspMAI CTGCAG 2 cut(s) 235, 682
BspPI GGATC 2 cut(s) 1133, 1146
BspQI GCTCTTC 1 cut(s) 633
BsrDI GCAATG 3 cut(s) 57, 120, 1049
BsrI ACTGG 4 cut(s) 665, 809, 1033, 1169
BssECI CCNNGG 4 cut(s) 95, 126, 610, 932
BssMI GATC 9 cut(s) 3, 308, 406, 565, 1057, 1095, 1138, 1156, 1282
BssSI CACGAG 1 cut(s) 822
BssT1I CCWWGG 2 cut(s) 610, 932
Bst2BI CACGAG 1 cut(s) 822
Bst2UI CCWGG 4 cut(s) 97, 128, 727, 798
Bst4CI ACNGT 3 cut(s) 265, 982, 1064
Bst6I CTCTTC 2 cut(s) 633, 780
BstAPI GCANNNNNTGC 3 cut(s) 275, 866, 1340
BstC8I GCNNGC 4 cut(s) 85, 89, 645, 1375
BstDEI CTNAG 4 cut(s) 393, 945, 1314, 1356
BstDSI CCRYGG 1 cut(s) 932
BstF5I GGATG 1 cut(s) 361
BstHHI GCGC 1 cut(s) 652
BstKTI GATC 9 cut(s) 6, 311, 409, 568, 1060, 1098, 1141, 1159, 1285
BstMBI GATC 9 cut(s) 3, 308, 406, 565, 1057, 1095, 1138, 1156, 1282
BstMWI GCNNNNNNNGC 9 cut(s) 224, 275, 478, 640, 649, 776, 866, 1319, 1340
BstNI CCWGG 4 cut(s) 97, 128, 727, 798
BstNSI RCATGY 2 cut(s) 647, 708
BstSCI CCNGG 4 cut(s) 95, 126, 725, 796
BstSFI CTRYAG 2 cut(s) 231, 678
BstV1I GCAGC 5 cut(s) 214, 217, 318, 634, 926
BstX2I RGATCY 1 cut(s) 1138
BstXI CCANNNNNNTGG 1 cut(s) 733
BstYI RGATCY 1 cut(s) 1138
Bsu15I ATCGAT 1 cut(s) 139
BsuRI GGCC 4 cut(s) 604, 700, 730, 1019
BsuTUI ATCGAT 1 cut(s) 139
BtgI CCRYGG 1 cut(s) 932
BtrI CACGTC 1 cut(s) 1070
BtsCI GGATG 1 cut(s) 361
BtsI GCAGTG 1 cut(s) 1308
BtsIMutI CAGTG 4 cut(s) 200, 1069, 1308, 1323
Cac8I GCNNGC 4 cut(s) 85, 89, 645, 1375
CaiI CAGNNNCTG 1 cut(s) 275
CciI TCATGA 1 cut(s) 1098
CfoI GCGC 1 cut(s) 652
Cfr13I GGNCC 4 cut(s) 602, 698, 1017, 1125
ClaI ATCGAT 1 cut(s) 139
CviAII CATG 6 cut(s) 644, 705, 767, 933, 1079, 1099
DdeI CTNAG 4 cut(s) 393, 945, 1314, 1356
DpnI GATC 9 cut(s) 5, 310, 408, 567, 1059, 1097, 1140, 1158, 1284
DpnII GATC 9 cut(s) 3, 308, 406, 565, 1057, 1095, 1138, 1156, 1282
Eam1104I CTCTTC 2 cut(s) 633, 780
EarI CTCTTC 2 cut(s) 633, 780
Ecl136II GAGCTC 1 cut(s) 250
Eco130I CCWWGG 2 cut(s) 610, 932
Eco147I AGGCCT 1 cut(s) 730
Eco24I GRGCYC 1 cut(s) 252
Eco47I GGWCC 1 cut(s) 1125
Eco53kI GAGCTC 1 cut(s) 250
Eco57I CTGAAG 2 cut(s) 510, 657
Eco88I CYCGRG 1 cut(s) 474
EcoICRI GAGCTC 1 cut(s) 250
EcoO109I RGGNCCY 2 cut(s) 1017, 1125
EcoRII CCWGG 4 cut(s) 95, 126, 725, 796
EcoT14I CCWWGG 2 cut(s) 610, 932
EcoT38I GRGCYC 1 cut(s) 252
ErhI CCWWGG 2 cut(s) 610, 932
FaeI CATG 6 cut(s) 647, 708, 770, 936, 1082, 1102
FaqI GGGAC 2 cut(s) 286, 1039
FatI CATG 6 cut(s) 643, 704, 766, 932, 1078, 1098
FbaI TGATCA 2 cut(s) 565, 1156
Fnu4HI GCNGC 5 cut(s) 228, 231, 332, 648, 915
FokI GGATG 1 cut(s) 368
FriOI GRGCYC 1 cut(s) 252
Fsp4HI GCNGC 5 cut(s) 228, 231, 332, 648, 915
FspBI CTAG 1 cut(s) 1011
GlaI GCGC 1 cut(s) 651
GluI GCNGC 5 cut(s) 228, 231, 332, 648, 915
GsuI CTGGAG 1 cut(s) 792
HaeIII GGCC 4 cut(s) 604, 700, 730, 1019
HapII CCGG 1 cut(s) 467
HhaI GCGC 1 cut(s) 652
Hin1II CATG 6 cut(s) 647, 708, 770, 936, 1082, 1102
Hin6I GCGC 1 cut(s) 650
HinP1I GCGC 1 cut(s) 650
HincII GTYRAC 2 cut(s) 794, 1189
HindII GTYRAC 2 cut(s) 794, 1189
HinfI GANTC 5 cut(s) 193, 538, 874, 941, 1082
HpaII CCGG 1 cut(s) 467
HphI GGTGA 1 cut(s) 986
Hpy166II GTNNAC 6 cut(s) 200, 261, 338, 794, 1067, 1189
Hpy188I TCNGA 3 cut(s) 313, 1198, 1401
Hpy8I GTNNAC 6 cut(s) 200, 261, 338, 794, 1067, 1189
HpyAV CCTTC 8 cut(s) 55, 428, 593, 696, 902, 1008, 1032, 1096
HpyCH4III ACNGT 3 cut(s) 265, 982, 1064
HpyCH4IV ACGT 1 cut(s) 1069
HpyF10VI GCNNNNNNNGC 9 cut(s) 224, 275, 478, 640, 649, 776, 866, 1319, 1340
HpyF3I CTNAG 4 cut(s) 393, 945, 1314, 1356
HpySE526I ACGT 1 cut(s) 1069
Hsp92II CATG 6 cut(s) 647, 708, 770, 936, 1082, 1102
HspAI GCGC 1 cut(s) 650
Kpn2I TCCGGA 1 cut(s) 466
Ksp22I TGATCA 2 cut(s) 565, 1156
Kzo9I GATC 9 cut(s) 3, 308, 406, 565, 1057, 1095, 1138, 1156, 1282
LguI GCTCTTC 1 cut(s) 633
LmnI GCTCC 3 cut(s) 247, 328, 469
Lsp1109I GCAGC 5 cut(s) 214, 217, 318, 634, 926
LweI GCATC 4 cut(s) 349, 847, 1189, 1360
MaeI CTAG 1 cut(s) 1011
MaeII ACGT 1 cut(s) 1069
MaeIII GTNAC 2 cut(s) 345, 758
MalI GATC 9 cut(s) 5, 310, 408, 567, 1059, 1097, 1140, 1158, 1284
MboI GATC 9 cut(s) 3, 308, 406, 565, 1057, 1095, 1138, 1156, 1282
MboII GAAGA 5 cut(s) 401, 650, 797, 1306, 1380
MfeI CAATTG 2 cut(s) 901, 1152
MflI RGATCY 1 cut(s) 1138
MhlI GDGCHC 3 cut(s) 252, 712, 1210
MluCI AATT 9 cut(s) 380, 430, 440, 500, 864, 901, 1106, 1152, 1192
MlyI GAGTC 1 cut(s) 935
MmeI TCCRAC 1 cut(s) 1200
MroI TCCGGA 1 cut(s) 466
MroXI GAANNNNTTC 2 cut(s) 44, 492
MseI TTAA 4 cut(s) 18, 374, 836, 1226
MslI CAYNNNNRTG 1 cut(s) 588
MspA1I CMGCKG 1 cut(s) 14
MspI CCGG 1 cut(s) 467
MspR9I CCNGG 4 cut(s) 97, 128, 727, 798
MunI CAATTG 2 cut(s) 901, 1152
MvaI CCWGG 4 cut(s) 97, 128, 727, 798
MwoI GCNNNNNNNGC 9 cut(s) 224, 275, 478, 640, 649, 776, 866, 1319, 1340
NcoI CCATGG 1 cut(s) 932
NdeII GATC 9 cut(s) 3, 308, 406, 565, 1057, 1095, 1138, 1156, 1282
NlaIII CATG 6 cut(s) 647, 708, 770, 936, 1082, 1102
NlaIV GGNNCC 4 cut(s) 28, 471, 699, 1140
NspI RCATGY 2 cut(s) 647, 708
PaeI GCATGC 1 cut(s) 647
PaeR7I CTCGAG 1 cut(s) 474
PagI TCATGA 1 cut(s) 1098
PceI AGGCCT 1 cut(s) 730
PciI ACATGT 1 cut(s) 704
PciSI GCTCTTC 1 cut(s) 633
PdmI GAANNNNTTC 2 cut(s) 44, 492
PfeI GAWTC 4 cut(s) 193, 538, 874, 1082
PflMI CCANNNNNTGG 1 cut(s) 611
PkrI GCNGC 5 cut(s) 229, 232, 333, 649, 916
PleI GAGTC 1 cut(s) 935
PpsI GAGTC 1 cut(s) 935
PpuMI RGGWCCY 1 cut(s) 1125
PscI ACATGT 1 cut(s) 704
Psp124BI GAGCTC 1 cut(s) 252
Psp5II RGGWCCY 1 cut(s) 1125
Psp6I CCWGG 4 cut(s) 95, 126, 725, 796
PspGI CCWGG 4 cut(s) 95, 126, 725, 796
PspN4I GGNNCC 4 cut(s) 28, 471, 699, 1140
PspPI GGNCC 4 cut(s) 602, 698, 1017, 1125
PspPPI RGGWCCY 1 cut(s) 1125
PstI CTGCAG 2 cut(s) 235, 682
PstNI CAGNNNCTG 1 cut(s) 275
PsuI RGATCY 1 cut(s) 1138
RseI CAYNNNNRTG 1 cut(s) 588
SacI GAGCTC 1 cut(s) 252
SapI GCTCTTC 1 cut(s) 633
SaqAI TTAA 4 cut(s) 18, 374, 836, 1226
SatI GCNGC 5 cut(s) 228, 231, 332, 648, 915
Sau3AI GATC 9 cut(s) 3, 308, 406, 565, 1057, 1095, 1138, 1156, 1282
Sau96I GGNCC 4 cut(s) 602, 698, 1017, 1125
SchI GAGTC 1 cut(s) 935
ScrFI CCNGG 4 cut(s) 97, 128, 727, 798
SduI GDGCHC 3 cut(s) 252, 712, 1210
SfaNI GCATC 4 cut(s) 349, 847, 1189, 1360
SfcI CTRYAG 2 cut(s) 231, 678
Sfr274I CTCGAG 1 cut(s) 474
SinI GGWCC 1 cut(s) 1125
SlaI CTCGAG 1 cut(s) 474
SmiMI CAYNNNNRTG 1 cut(s) 588
SmlI CTYRAG 4 cut(s) 71, 474, 483, 968
SmoI CTYRAG 4 cut(s) 71, 474, 483, 968
SphI GCATGC 1 cut(s) 647
Sse9I AATT 9 cut(s) 380, 430, 440, 500, 864, 901, 1106, 1152, 1192
SseBI AGGCCT 1 cut(s) 730
SsiI CCGC 2 cut(s) 14, 513
SspI AATATT 1 cut(s) 1381
SspMI CTAG 1 cut(s) 1011
SstI GAGCTC 1 cut(s) 252
StuI AGGCCT 1 cut(s) 730
StyD4I CCNGG 4 cut(s) 95, 126, 725, 796
StyI CCWWGG 2 cut(s) 610, 932
TaaI ACNGT 3 cut(s) 265, 982, 1064
TaiI ACGT 1 cut(s) 1072
TaqI TCGA 3 cut(s) 139, 475, 549
TasI AATT 9 cut(s) 380, 430, 440, 500, 864, 901, 1106, 1152, 1192
TfiI GAWTC 4 cut(s) 193, 538, 874, 1082
Tru1I TTAA 4 cut(s) 18, 374, 836, 1226
Tru9I TTAA 4 cut(s) 18, 374, 836, 1226
TscAI CASTG 4 cut(s) 207, 1069, 1315, 1330
TseI GCWGC 5 cut(s) 227, 230, 331, 647, 914
TspDTI ATGAA 7 cut(s) 100, 410, 572, 612, 755, 1095, 1115
TspGWI ACGGA 1 cut(s) 178
TspRI CASTG 4 cut(s) 207, 1069, 1315, 1330
Van91I CCANNNNNTGG 1 cut(s) 611
VpaK11BI GGWCC 1 cut(s) 1125
XapI RAATTY 2 cut(s) 500, 1106
XceI RCATGY 2 cut(s) 647, 708
XhoI CTCGAG 1 cut(s) 474
XmnI GAANNNNTTC 2 cut(s) 44, 492
XspI CTAG 1 cut(s) 1011
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.