Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000861.1

Orthogroup ID

OG0008895

Physical Location & Seq

Genomic Coordinates Reverse (-)

142927 .. 143253

Gene Structure 327 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000861.1_g000032.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 327 bp

atgaaaaaaggtagggagaaaacacaggaggatgaagatataccgaagttgcgagatgaagatcgagcagaaagttatcatgggaaattcttggagcaactgaggaagcagaaacaaattaagccatcttcccagtcatcagtgttaaagactataatcctattccactggaaggagatttcactatctggtttgtttgctttgctgaaggtacttactacaagtgctggtcctttgcttctcaatgccttcattagggttgcaaagggaaatgaaatttccgagcacgaaggcactggtacttcaggtgcaggcttattggtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000325 GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0006810 GO:0008150 GO:0015399 GO:0015405 GO:0016020 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022804 GO:0022857 GO:0031090 GO:0042623 GO:0042626 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043492 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0098588 GO:0098805

KEGG Pathways

Metabolic & Signaling

ko01523 ko01524 ko02010 ko04976 map01523 map01524 map02010 map04976

Pfam Domains

Protein Families

ABC_membrane ABC_tran

Protein Analysis

108

Amino Acids

12.03

Weight (kDa)

9.26

Isoelectric Point (pI)

33.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008895)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0383001 RchiOBHm_Chr1g0383011 RchiOBHm_Chr5g0041751 RchiOBHm_Chr5g0041761 RchiOBHm_Chr5g0041771
rosa_laevigata	RLG00000026140
rosa_multiflora	Rmu_sc0000861.1_g000032 Rmu_sc0000861.1_g000034 Rmu_sc0005255.1_g000013 Rmu_sc0005255.1_g000014
rosa_roxburghii	Rroxscaffold_1G00038760 Rroxscaffold_4G00277700 Rroxscaffold_4G00277710
rosa_rugosa	Rorug01G0437600
rosa_samantha	Rh1AG463200 Rh1BG420300 Rh1CG408600 Rh1CG433900 Rh1DG453000 Rh5BG286300 Rh5BG286500 Rh5DG295000 Rh5DG295100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	86, 276
AcuI	CTGAAG	2 cut(s)	227, 288
AfaI	GTAC	2 cut(s)	213, 301
AfiI	CCNNNNNNNGG	2 cut(s)	172, 255
Alw21I	GWGCWC	1 cut(s)	288
ApoI	RAATTY	2 cut(s)	86, 276
AspS9I	GGNCC	1 cut(s)	230
AvaII	GGWCC	1 cut(s)	230
Bbv12I	GWGCWC	1 cut(s)	288
BccI	CCATC	1 cut(s)	133
Bme18I	GGWCC	1 cut(s)	230
BmgT120I	GGNCC	1 cut(s)	230
BmrI	ACTGGG	1 cut(s)	127
BmuI	ACTGGG	1 cut(s)	127
BsaBI	GATNNNNATC	1 cut(s)	60
Bsc4I	CCNNNNNNNGG	2 cut(s)	172, 255
Bse1I	ACTGG	3 cut(s)	133, 173, 301
Bse8I	GATNNNNATC	1 cut(s)	60
BseGI	GGATG	1 cut(s)	37
BseJI	GATNNNNATC	1 cut(s)	60
BseLI	CCNNNNNNNGG	2 cut(s)	172, 255
BseMII	CTCAG	1 cut(s)	92
BseNI	ACTGG	3 cut(s)	133, 173, 301
BsiHKAI	GWGCWC	1 cut(s)	288
BslI	CCNNNNNNNGG	2 cut(s)	172, 255
Bsp1286I	GDGCHC	1 cut(s)	288
Bsp143I	GATC	1 cut(s)	61
BspCNI	CTCAG	1 cut(s)	93
BsrI	ACTGG	3 cut(s)	133, 173, 301
BssMI	GATC	1 cut(s)	61
BstC8I	GCNNGC	1 cut(s)	313
BstDEI	CTNAG	1 cut(s)	101
BstENI	CCTNNNNNAGG	1 cut(s)	253
BstF5I	GGATG	1 cut(s)	37
BstKTI	GATC	1 cut(s)	64
BstMBI	GATC	1 cut(s)	61
BtsCI	GGATG	1 cut(s)	37
BtsIMutI	CAGTG	3 cut(s)	147, 166, 294
Cac8I	GCNNGC	1 cut(s)	313
Cfr13I	GGNCC	1 cut(s)	230
Csp6I	GTAC	2 cut(s)	212, 300
CviAII	CATG	1 cut(s)	80
CviJI	RGCY	2 cut(s)	124, 315
CviKI_1	RGCY	2 cut(s)	124, 315
CviQI	GTAC	2 cut(s)	212, 300
DdeI	CTNAG	1 cut(s)	101
DpnI	GATC	1 cut(s)	63
DpnII	GATC	1 cut(s)	61
Eco47I	GGWCC	1 cut(s)	230
Eco57I	CTGAAG	2 cut(s)	227, 288
EcoNI	CCTNNNNNAGG	1 cut(s)	253
FaeI	CATG	1 cut(s)	83
FaiI	YATR	3 cut(s)	41, 81, 155
FatI	CATG	1 cut(s)	79
FokI	GGATG	1 cut(s)	44
Hin1II	CATG	1 cut(s)	83
Hpy188I	TCNGA	1 cut(s)	283
HpyAV	CCTTC	4 cut(s)	166, 202, 259, 284
HpyCH4V	TGCA	2 cut(s)	263, 311
HpyF3I	CTNAG	1 cut(s)	101
Hsp92II	CATG	1 cut(s)	83
Kzo9I	GATC	1 cut(s)	61
LmnI	GCTCC	1 cut(s)	94
LpnPI	CCDG	8 cut(s)	11, 146, 154, 174, 213, 282, 291, 297
MalI	GATC	1 cut(s)	63
MboI	GATC	1 cut(s)	61
MboII	GAAGA	3 cut(s)	47, 71, 120
MhlI	GDGCHC	1 cut(s)	288
MluCI	AATT	3 cut(s)	86, 117, 276
MnlI	CCTC	2 cut(s)	22, 96
MseI	TTAA	2 cut(s)	120, 146
NdeII	GATC	1 cut(s)	61
NlaIII	CATG	1 cut(s)	83
PspPI	GGNCC	1 cut(s)	230
RsaI	GTAC	2 cut(s)	213, 301
RsaNI	GTAC	2 cut(s)	212, 300
SaqAI	TTAA	2 cut(s)	120, 146
Sau3AI	GATC	1 cut(s)	61
Sau96I	GGNCC	1 cut(s)	230
SduI	GDGCHC	1 cut(s)	288
SetI	ASST	3 cut(s)	13, 213, 310
SinI	GGWCC	1 cut(s)	230
Sse9I	AATT	3 cut(s)	86, 117, 276
TaqI	TCGA	1 cut(s)	64
TasI	AATT	3 cut(s)	86, 117, 276
Tru1I	TTAA	2 cut(s)	120, 146
Tru9I	TTAA	2 cut(s)	120, 146
TscAI	CASTG	3 cut(s)	147, 173, 301
TspDTI	ATGAA	5 cut(s)	17, 48, 72, 241, 288
TspRI	CASTG	3 cut(s)	147, 173, 301
VpaK11BI	GGWCC	1 cut(s)	230
XagI	CCTNNNNNAGG	1 cut(s)	253
XapI	RAATTY	2 cut(s)	86, 276

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.