Rmu_sc0005255.1_g000013

WD domain, G-beta repeat

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005255.1
Physical Location & Seq
Forward (+)
62721 .. 63063
343 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005255.1_g000013.1.cds

Sequence Viewer

Length: 249 bp
atgccatcattttctcttagcggtggcaacccctcctatcctctggttgtagcagctcatccatctgaacctaaccagattgcagttggcatgactgacgggtcagtgcatgtggttgaaccatctgatgcagagctgaagtggggtggcacaccctctcaagataatggtccttccaattcatcaaattcgtctcctagtggtcaagcatcagatagtacttccttcgagatgaatatggctagttaa

Protein Analysis

82

Amino Acids

8.31

Weight (kDa)

4.07

Isoelectric Point (pI)

51.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 100
AciI CCGC 1 cut(s) 21
AcsI RAATTY 1 cut(s) 187
AcuI CTGAAG 1 cut(s) 158
AfaI GTAC 1 cut(s) 220
AgsI TTSAA 1 cut(s) 119
AluBI AGCT 2 cut(s) 56, 136
AluI AGCT 2 cut(s) 56, 136
Alw26I GTCTC 1 cut(s) 198
ApeKI GCWGC 1 cut(s) 53
ApoI RAATTY 1 cut(s) 187
AspS9I GGNCC 1 cut(s) 170
AvaII GGWCC 1 cut(s) 170
BbvI GCAGC 1 cut(s) 65
BccI CCATC 3 cut(s) 13, 70, 130
BcoDI GTCTC 1 cut(s) 198
BfaI CTAG 2 cut(s) 198, 243
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
BmcAI AGTACT 1 cut(s) 220
Bme18I GGWCC 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 170
BmsI GCATC 2 cut(s) 118, 218
BpuEI CTTGAG 1 cut(s) 144
BseGI GGATG 1 cut(s) 58
BseXI GCAGC 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 198
BsmBI CGTCTC 1 cut(s) 198
BspACI CCGC 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 17
BstF5I GGATG 1 cut(s) 58
BstMAI GTCTC 1 cut(s) 198
BstNSI RCATGY 1 cut(s) 113
BstV1I GCAGC 1 cut(s) 65
BtsCI GGATG 1 cut(s) 58
BtsIMutI CAGTG 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 170
Csp6I GTAC 1 cut(s) 219
CviAII CATG 2 cut(s) 91, 110
CviJI RGCY 3 cut(s) 56, 136, 242
CviKI_1 RGCY 3 cut(s) 56, 136, 242
CviQI GTAC 1 cut(s) 219
DdeI CTNAG 1 cut(s) 17
DrdI GACNNNNNNGTC 1 cut(s) 100
DseDI GACNNNNNNGTC 1 cut(s) 100
Eco47I GGWCC 1 cut(s) 170
Eco57I CTGAAG 1 cut(s) 158
Esp3I CGTCTC 1 cut(s) 198
FaeI CATG 2 cut(s) 94, 113
FaiI YATR 3 cut(s) 92, 111, 239
FatI CATG 2 cut(s) 90, 109
Fnu4HI GCNGC 1 cut(s) 54
FokI GGATG 1 cut(s) 45
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 2 cut(s) 198, 243
GluI GCNGC 1 cut(s) 54
Hin1II CATG 2 cut(s) 94, 113
Hpy188I TCNGA 3 cut(s) 67, 127, 214
Hpy188III TCNNGA 2 cut(s) 161, 229
HpyAV CCTTC 2 cut(s) 183, 235
HpyCH4V TGCA 3 cut(s) 83, 109, 131
HpyF3I CTNAG 1 cut(s) 17
Hsp92II CATG 2 cut(s) 94, 113
LpnPI CCDG 2 cut(s) 29, 89
Lsp1109I GCAGC 1 cut(s) 65
LweI GCATC 2 cut(s) 118, 218
MaeI CTAG 2 cut(s) 198, 243
MluCI AATT 2 cut(s) 178, 187
MnlI CCTC 3 cut(s) 43, 51, 166
MseI TTAA 1 cut(s) 247
NlaIII CATG 2 cut(s) 94, 113
NspI RCATGY 1 cut(s) 113
PkrI GCNGC 1 cut(s) 55
PspPI GGNCC 1 cut(s) 170
RsaI GTAC 1 cut(s) 220
RsaNI GTAC 1 cut(s) 219
SaqAI TTAA 1 cut(s) 247
SatI GCNGC 1 cut(s) 54
Sau96I GGNCC 1 cut(s) 170
ScaI AGTACT 1 cut(s) 220
SetI ASST 3 cut(s) 58, 73, 138
SfaNI GCATC 2 cut(s) 118, 218
SgeI CNNG 9 cut(s) 56, 88, 103, 112, 122, 173, 210, 218, 241
SinI GGWCC 1 cut(s) 170
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
Sse9I AATT 2 cut(s) 178, 187
SsiI CCGC 1 cut(s) 21
SspMI CTAG 2 cut(s) 198, 243
TaqI TCGA 1 cut(s) 228
TasI AATT 2 cut(s) 178, 187
TatI WGTACW 1 cut(s) 218
Tru1I TTAA 1 cut(s) 247
Tru9I TTAA 1 cut(s) 247
TscAI CASTG 1 cut(s) 111
TseI GCWGC 1 cut(s) 53
TspDTI ATGAA 2 cut(s) 171, 248
TspRI CASTG 1 cut(s) 111
VpaK11BI GGWCC 1 cut(s) 170
XapI RAATTY 1 cut(s) 187
XceI RCATGY 1 cut(s) 113
XcmI CCANNNNNNNNNTGG 1 cut(s) 83
XspI CTAG 2 cut(s) 198, 243
ZrmI AGTACT 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.