Rmu_sc0005255.1_g000014

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005255.1
Physical Location & Seq
Forward (+)
65324 .. 66572
1249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005255.1_g000014.1.cds

Sequence Viewer

Length: 861 bp
atggatccgtgtccgcattcagtgttgcaaaagacagatgaatcagaaaaagtaagtgaagaacctaaacttcactctgactcaagtggggtgaaacctatggtaggtgacagggatgaagtaatggggtataagtatgaagatggtgatgagatcatcagatctagtgacaatggcctttatacccctcttaatggtgagtccaatggaattagtaaaggtaatgatcatgcaaccccatttagcaaagctggattgtttagtaaaatgtcattttggtggttaaattcattgatgaaaaaaggtagggagaaaactcaggaggatgaagatataccgaagttgcgagatgaagatcgagcagaaagttgtcatgggatattcttggagcaactgaggaagcagaaacaaattaagccatcttcccagtcatcagtgttaaagactataatcctattccactggaaggagatttcactatctggtttgtttgctttgctgaagatacttactacaagtgctggtcctttgcttctcaatgccttcattagggttgcaaagggaaatgaaagtgtttggctccaaaaccagttggcatgcaatctgtctcttttgagcgtgagagcaccaacctcgccacaaggttcttctctagccttccgagaaaggacttcttgccttaaggataaggactttggatatgatctctttgcgtcaccgaatcgatactcaacgtttaaccgtggcagtagcactgacaatcggctcttggagagactaggactggaagtacggtcgccgggtttcaacaaggttgaaggtttgctccggggaggctttgtaatcgctgggattgattga

Protein Analysis

286

Amino Acids

31.86

Weight (kDa)

6.97

Isoelectric Point (pI)

45.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 14
AclI AACGTT 1 cut(s) 734
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 286
AcuI CTGAAG 1 cut(s) 521
AfaI GTAC 1 cut(s) 792
AfiI CCNNNNNNNGG 4 cut(s) 104, 194, 466, 549
AflII CTTAAG 1 cut(s) 680
AgsI TTSAA 2 cut(s) 808, 818
AluBI AGCT 1 cut(s) 251
AluI AGCT 1 cut(s) 251
Alw21I GWGCWC 1 cut(s) 628
Alw26I GTCTC 2 cut(s) 612, 769
AlwI GGATC 1 cut(s) 12
AoxI GGCC 1 cut(s) 175
ApoI RAATTY 1 cut(s) 286
AspS9I GGNCC 1 cut(s) 524
AsuC2I CCSGG 2 cut(s) 801, 830
AsuHPI GGTGA 5 cut(s) 103, 119, 158, 209, 708
AvaII GGWCC 1 cut(s) 524
BamHI GGATCC 1 cut(s) 4
Bbv12I GWGCWC 1 cut(s) 628
BccI CCATC 2 cut(s) 137, 427
BcgI CGANNNNNNTGC 2 cut(s) 615, 649
BclI TGATCA 1 cut(s) 226
BcnI CCSGG 2 cut(s) 801, 830
BcoDI GTCTC 2 cut(s) 612, 769
BfaI CTAG 3 cut(s) 165, 653, 779
BfrI CTTAAG 1 cut(s) 680
BglII AGATCT 1 cut(s) 161
Bme1390I CCNGG 2 cut(s) 801, 830
Bme18I GGWCC 1 cut(s) 524
BmgT120I GGNCC 1 cut(s) 524
BmiI GGNNCC 2 cut(s) 6, 581
BmrFI CCNGG 2 cut(s) 801, 830
BmrI ACTGGG 1 cut(s) 421
BmuI ACTGGG 1 cut(s) 421
BpuEI CTTGAG 1 cut(s) 67
BpuMI CCSGG 2 cut(s) 801, 830
Bsa29I ATCGAT 1 cut(s) 724
BsaBI GATNNNNATC 1 cut(s) 354
BsaJI CCNNGG 2 cut(s) 742, 829
BsaXI ACNNNNNCTCC 2 cut(s) 825, 855
Bsc4I CCNNNNNNNGG 4 cut(s) 104, 194, 466, 549
Bse1I ACTGG 4 cut(s) 427, 467, 589, 789
Bse8I GATNNNNATC 1 cut(s) 354
BseCI ATCGAT 1 cut(s) 724
BseDI CCNNGG 2 cut(s) 742, 829
BseGI GGATG 2 cut(s) 121, 331
BseJI GATNNNNATC 1 cut(s) 354
BseLI CCNNNNNNNGG 4 cut(s) 104, 194, 466, 549
BseMII CTCAG 2 cut(s) 332, 386
BseNI ACTGG 4 cut(s) 427, 467, 589, 789
BseYI CCCAGC 1 cut(s) 848
Bsh1285I CGRYCG 1 cut(s) 797
BshFI GGCC 1 cut(s) 177
BshVI ATCGAT 1 cut(s) 724
BsiEI CGRYCG 1 cut(s) 797
BsiHKAI GWGCWC 1 cut(s) 628
BsiSI CCGG 2 cut(s) 800, 829
BslI CCNNNNNNNGG 4 cut(s) 104, 194, 466, 549
BsmAI GTCTC 2 cut(s) 612, 769
BsmI GAATGC 1 cut(s) 16
BsnI GGCC 1 cut(s) 177
Bsp1286I GDGCHC 1 cut(s) 628
Bsp143I GATC 6 cut(s) 4, 153, 161, 226, 355, 703
BspACI CCGC 1 cut(s) 14
BspANI GGCC 1 cut(s) 177
BspCNI CTCAG 2 cut(s) 331, 387
BspDI ATCGAT 1 cut(s) 724
BspLI GGNNCC 2 cut(s) 6, 581
BspPI GGATC 1 cut(s) 12
BspTI CTTAAG 1 cut(s) 680
BsrI ACTGG 4 cut(s) 427, 467, 589, 789
BssECI CCNNGG 2 cut(s) 742, 829
BssMI GATC 6 cut(s) 4, 153, 161, 226, 355, 703
Bst4CI ACNGT 2 cut(s) 743, 795
BstAFI CTTAAG 1 cut(s) 680
BstC8I GCNNGC 1 cut(s) 598
BstDEI CTNAG 2 cut(s) 318, 395
BstDSI CCRYGG 1 cut(s) 742
BstENI CCTNNNNNAGG 2 cut(s) 102, 547
BstF5I GGATG 2 cut(s) 121, 331
BstKTI GATC 6 cut(s) 7, 156, 164, 229, 358, 706
BstMAI GTCTC 2 cut(s) 612, 769
BstMBI GATC 6 cut(s) 4, 153, 161, 226, 355, 703
BstMCI CGRYCG 1 cut(s) 797
BstNSI RCATGY 1 cut(s) 600
BstSCI CCNGG 2 cut(s) 799, 828
BstX2I RGATCY 2 cut(s) 4, 161
BstYI RGATCY 2 cut(s) 4, 161
Bsu15I ATCGAT 1 cut(s) 724
BsuRI GGCC 1 cut(s) 177
BsuTUI ATCGAT 1 cut(s) 724
BtgI CCRYGG 1 cut(s) 742
BtsCI GGATG 2 cut(s) 121, 331
BtsIMutI CAGTG 4 cut(s) 27, 441, 460, 753
Cac8I GCNNGC 1 cut(s) 598
Cfr13I GGNCC 1 cut(s) 524
ClaI ATCGAT 1 cut(s) 724
CseI GACGC 1 cut(s) 702
Csp6I GTAC 1 cut(s) 791
CviAII CATG 3 cut(s) 230, 374, 597
CviJI RGCY 7 cut(s) 177, 251, 418, 580, 656, 766, 837
CviKI_1 RGCY 7 cut(s) 177, 251, 418, 580, 656, 766, 837
CviQI GTAC 1 cut(s) 791
DdeI CTNAG 2 cut(s) 318, 395
DpnI GATC 6 cut(s) 6, 155, 163, 228, 357, 705
DpnII GATC 6 cut(s) 4, 153, 161, 226, 355, 703
Eco47I GGWCC 1 cut(s) 524
Eco57I CTGAAG 1 cut(s) 521
EcoNI CCTNNNNNAGG 2 cut(s) 102, 547
FaeI CATG 3 cut(s) 233, 377, 600
FalI AAGNNNNNCTT 2 cut(s) 658, 690
FatI CATG 3 cut(s) 229, 373, 596
FbaI TGATCA 1 cut(s) 226
FokI GGATG 2 cut(s) 128, 338
FspBI CTAG 3 cut(s) 165, 653, 779
GsaI CCCAGC 1 cut(s) 852
HaeIII GGCC 1 cut(s) 177
HapII CCGG 2 cut(s) 800, 829
HgaI GACGC 1 cut(s) 702
Hin1II CATG 3 cut(s) 233, 377, 600
HinfI GANTC 4 cut(s) 41, 80, 200, 721
HpaII CCGG 2 cut(s) 800, 829
HphI GGTGA 5 cut(s) 103, 119, 158, 209, 708
Hpy188I TCNGA 4 cut(s) 46, 79, 161, 662
Hpy188III TCNNGA 1 cut(s) 320
HpyAV CCTTC 4 cut(s) 460, 553, 667, 812
HpyCH4III ACNGT 2 cut(s) 743, 795
HpyCH4IV ACGT 1 cut(s) 734
HpyCH4V TGCA 4 cut(s) 28, 233, 557, 600
HpyF3I CTNAG 2 cut(s) 318, 395
HpySE526I ACGT 1 cut(s) 734
Hsp92II CATG 3 cut(s) 233, 377, 600
Ksp22I TGATCA 1 cut(s) 226
Kzo9I GATC 6 cut(s) 4, 153, 161, 226, 355, 703
LmnI GCTCC 3 cut(s) 388, 585, 831
MaeI CTAG 3 cut(s) 165, 653, 779
MaeII ACGT 1 cut(s) 734
MaeIII GTNAC 3 cut(s) 107, 167, 714
MalI GATC 6 cut(s) 6, 155, 163, 228, 357, 705
MboI GATC 6 cut(s) 4, 153, 161, 226, 355, 703
MboII GAAGA 7 cut(s) 71, 152, 341, 365, 414, 514, 639
MflI RGATCY 2 cut(s) 4, 161
MhlI GDGCHC 1 cut(s) 628
MluCI AATT 3 cut(s) 210, 286, 411
MlyI GAGTC 2 cut(s) 74, 209
MnlI CCTC 5 cut(s) 198, 316, 390, 643, 827
MseI TTAA 6 cut(s) 192, 284, 414, 440, 681, 738
MslI CAYNNNNRTG 1 cut(s) 277
MspCI CTTAAG 1 cut(s) 680
MspI CCGG 2 cut(s) 800, 829
MspR9I CCNGG 2 cut(s) 801, 830
Mva1269I GAATGC 1 cut(s) 16
NciI CCSGG 2 cut(s) 801, 830
NdeII GATC 6 cut(s) 4, 153, 161, 226, 355, 703
NlaIII CATG 3 cut(s) 233, 377, 600
NlaIV GGNNCC 2 cut(s) 6, 581
NmuCI GTSAC 3 cut(s) 107, 167, 714
NspI RCATGY 1 cut(s) 600
PaeI GCATGC 1 cut(s) 600
PctI GAATGC 1 cut(s) 16
PfeI GAWTC 2 cut(s) 41, 721
PleI GAGTC 2 cut(s) 74, 208
PpsI GAGTC 2 cut(s) 74, 208
Psp1406I AACGTT 1 cut(s) 734
PspFI CCCAGC 1 cut(s) 848
PspN4I GGNNCC 2 cut(s) 6, 581
PspPI GGNCC 1 cut(s) 524
PsuI RGATCY 2 cut(s) 4, 161
RsaI GTAC 1 cut(s) 792
RsaNI GTAC 1 cut(s) 791
RseI CAYNNNNRTG 1 cut(s) 277
SaqAI TTAA 6 cut(s) 192, 284, 414, 440, 681, 738
Sau3AI GATC 6 cut(s) 4, 153, 161, 226, 355, 703
Sau96I GGNCC 1 cut(s) 524
SchI GAGTC 2 cut(s) 74, 209
ScrFI CCNGG 2 cut(s) 801, 830
SduI GDGCHC 1 cut(s) 628
SinI GGWCC 1 cut(s) 524
SmiMI CAYNNNNRTG 1 cut(s) 277
SmlI CTYRAG 2 cut(s) 82, 680
SmoI CTYRAG 2 cut(s) 82, 680
SphI GCATGC 1 cut(s) 600
Sse9I AATT 3 cut(s) 210, 286, 411
SsiI CCGC 1 cut(s) 14
SspMI CTAG 3 cut(s) 165, 653, 779
StyD4I CCNGG 2 cut(s) 799, 828
TaaI ACNGT 2 cut(s) 743, 795
TaiI ACGT 1 cut(s) 737
TaqI TCGA 2 cut(s) 358, 724
TasI AATT 3 cut(s) 210, 286, 411
TfiI GAWTC 2 cut(s) 41, 721
Tru1I TTAA 6 cut(s) 192, 284, 414, 440, 681, 738
Tru9I TTAA 6 cut(s) 192, 284, 414, 440, 681, 738
TscAI CASTG 4 cut(s) 27, 441, 467, 760
TseFI GTSAC 3 cut(s) 107, 167, 714
Tsp45I GTSAC 3 cut(s) 107, 167, 714
TspDTI ATGAA 9 cut(s) 54, 132, 153, 279, 311, 342, 366, 535, 582
TspRI CASTG 4 cut(s) 27, 441, 467, 760
Vha464I CTTAAG 1 cut(s) 680
VpaK11BI GGWCC 1 cut(s) 524
XagI CCTNNNNNAGG 2 cut(s) 102, 547
XapI RAATTY 1 cut(s) 286
XceI RCATGY 1 cut(s) 600
XspI CTAG 3 cut(s) 165, 653, 779
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.