Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000902.1

Orthogroup ID

OG0005926

Physical Location & Seq

Genomic Coordinates Forward (+)

33538 .. 34872

Gene Structure 1335 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000902.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 612 bp

atgttgcgcttggaatttgctcattatgactacaaatcaaaaggaaccataacagctaaagattttgccttgtccttggttgcatctgctgatctcagtgtcttatacaagttgcttgatcgtgttgacgatattaacaacgccccacgtcttaacaacatacaaattacatacaaggaatttaaagattttgcagagctacgcaagaatttgcggtctttctctttggccattttcagctacggcgaggttaatggggttttgacaaaatcagatctccagagagcagcttccaaagtatgtggcatcaatgtttcagacaatgtgatggacataatcttccatgtatttgatgcaaacggtgatggtgatctaagtgcgaacgagcaccaaaaccccacaaatgctgaccaatctgaggcaattcctgcagtcgatgctaacaacaatagccaatctgacgtggcaactgacattgcaaattctcttgcttcaatgcttgataatgaaaatggtcaggttgggggtccttcaactaatgcagaaatggaaagcgaacttgctgaagaactagcacaaggagatgctttcactgaatatgacagactatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EF-hand_1 EF-hand_5 EF-hand_8

Protein Analysis

203

Amino Acids

22.21

Weight (kDa)

4.35

Isoelectric Point (pI)

24.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005926)

Species	Orthologous Gene IDs
malus_domestica	MD02G1018100.v1.1 MD15G1162000.v1.1
prunus_persica	Prupe.7G257300_v2.0.a1
pyrus_communis	pycom15g14560
rosa_chinensis	RchiOBHm_Chr2g0087011 RchiOBHm_Chr7g0219711
rosa_laevigata	RLG00000002277 RLG00000015822
rosa_multiflora	Rmu_sc0000902.1_g000013 Rmu_sc0000902.1_g000014 Rmu_sc0010698.1_g000002
rosa_roxburghii	Rroxscaffold_2G00153960 Rroxscaffold_3G00239910 Rroxscaffold_3G00239920 Rroxscaffold_3G00239930
rosa_rugosa	Rorug01G0471500 Rorug07G0186800
rosa_samantha	Rh2AG024300 Rh2BG024800 Rh2CG024900 Rh2DG024800 Rh7AG330900 Rh7BG320600 Rh7CG348200 Rh7DG326300
rosa_wichuraiana	Rw2G001910 Rw2G001960 Rw7G027850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	214
AcoI	YGGCCR	1 cut(s)	228
AcsI	RAATTY	4 cut(s)	14, 179, 208, 481
AcuI	CTGAAG	1 cut(s)	585
AfiI	CCNNNNNNNGG	1 cut(s)	418
AgsI	TTSAA	2 cut(s)	495, 534
AjiI	CACGTC	2 cut(s)	149, 463
AluBI	AGCT	4 cut(s)	56, 199, 240, 290
AluI	AGCT	4 cut(s)	56, 199, 240, 290
Alw21I	GWGCWC	1 cut(s)	390
AoxI	GGCC	1 cut(s)	228
ApeKI	GCWGC	1 cut(s)	287
ApoI	RAATTY	4 cut(s)	14, 179, 208, 481
AspLEI	GCGC	1 cut(s)	9
AspS9I	GGNCC	1 cut(s)	527
AsuHPI	GGTGA	2 cut(s)	374, 380
AvaII	GGWCC	1 cut(s)	527
BalI	TGGCCA	1 cut(s)	230
Bbv12I	GWGCWC	1 cut(s)	390
BbvI	GCAGC	1 cut(s)	299
BccI	CCATC	2 cut(s)	322, 359
BceAI	ACGGC	1 cut(s)	259
BfaI	CTAG	1 cut(s)	572
BfmI	CTRYAG	1 cut(s)	429
BglII	AGATCT	1 cut(s)	274
BisI	GCNGC	1 cut(s)	288
BlsI	GCNGC	1 cut(s)	289
Bme18I	GGWCC	1 cut(s)	527
BmgBI	CACGTC	2 cut(s)	149, 463
BmgT120I	GGNCC	1 cut(s)	527
BmiI	GGNNCC	2 cut(s)	46, 528
BmsI	GCATC	5 cut(s)	92, 315, 343, 427, 574
BpmI	CTGGAG	1 cut(s)	263
BsaBI	GATNNNNATC	1 cut(s)	369
BsaJI	CCNNGG	1 cut(s)	75
Bsc4I	CCNNNNNNNGG	1 cut(s)	418
Bse3DI	GCAATG	1 cut(s)	474
Bse8I	GATNNNNATC	1 cut(s)	369
BseDI	CCNNGG	1 cut(s)	75
BseJI	GATNNNNATC	1 cut(s)	369
BseLI	CCNNNNNNNGG	1 cut(s)	418
BseMI	GCAATG	1 cut(s)	474
BseMII	CTCAG	2 cut(s)	109, 408
BseXI	GCAGC	1 cut(s)	299
BshFI	GGCC	1 cut(s)	230
BsiHKAI	GWGCWC	1 cut(s)	390
BslI	CCNNNNNNNGG	1 cut(s)	418
BsnI	GGCC	1 cut(s)	230
Bsp1286I	GDGCHC	1 cut(s)	390
Bsp143I	GATC	4 cut(s)	91, 118, 274, 370
BspACI	CCGC	1 cut(s)	214
BspANI	GGCC	1 cut(s)	230
BspCNI	CTCAG	2 cut(s)	108, 409
BspLI	GGNNCC	2 cut(s)	46, 528
BspMAI	CTGCAG	1 cut(s)	433
BsrDI	GCAATG	1 cut(s)	474
BssECI	CCNNGG	1 cut(s)	75
BssMI	GATC	4 cut(s)	91, 118, 274, 370
BssT1I	CCWWGG	1 cut(s)	75
Bst4CI	ACNGT	1 cut(s)	362
BstAPI	GCANNNNNTGC	2 cut(s)	428, 437
BstDEI	CTNAG	3 cut(s)	95, 374, 417
BstHHI	GCGC	1 cut(s)	9
BstKTI	GATC	4 cut(s)	94, 121, 277, 373
BstMBI	GATC	4 cut(s)	91, 118, 274, 370
BstMWI	GCNNNNNNNGC	2 cut(s)	428, 437
BstSFI	CTRYAG	1 cut(s)	429
BstV1I	GCAGC	1 cut(s)	299
BstX2I	RGATCY	1 cut(s)	274
BstYI	RGATCY	1 cut(s)	274
BsuRI	GGCC	1 cut(s)	230
BtrI	CACGTC	2 cut(s)	149, 463
BtsIMutI	CAGTG	2 cut(s)	103, 591
CfoI	GCGC	1 cut(s)	9
Cfr13I	GGNCC	1 cut(s)	527
CspCI	CAANNNNNGTGG	2 cut(s)	283, 318
CviAII	CATG	1 cut(s)	344
CviJI	RGCY	6 cut(s)	56, 199, 230, 240, 290, 453
CviKI_1	RGCY	6 cut(s)	56, 199, 230, 240, 290, 453
DdeI	CTNAG	3 cut(s)	95, 374, 417
DpnI	GATC	4 cut(s)	93, 120, 276, 372
DpnII	GATC	4 cut(s)	91, 118, 274, 370
DraI	TTTAAA	1 cut(s)	184
EaeI	YGGCCR	1 cut(s)	228
Eco130I	CCWWGG	1 cut(s)	75
Eco47I	GGWCC	1 cut(s)	527
Eco57I	CTGAAG	1 cut(s)	585
EcoO109I	RGGNCCY	1 cut(s)	527
EcoT14I	CCWWGG	1 cut(s)	75
ErhI	CCWWGG	1 cut(s)	75
FaeI	CATG	1 cut(s)	347
FatI	CATG	1 cut(s)	343
Fnu4HI	GCNGC	1 cut(s)	288
Fsp4HI	GCNGC	1 cut(s)	288
FspBI	CTAG	1 cut(s)	572
GlaI	GCGC	1 cut(s)	8
GluI	GCNGC	1 cut(s)	288
GsuI	CTGGAG	1 cut(s)	263
HaeIII	GGCC	1 cut(s)	230
HhaI	GCGC	1 cut(s)	9
Hin1II	CATG	1 cut(s)	347
Hin6I	GCGC	1 cut(s)	7
HinP1I	GCGC	1 cut(s)	7
HincII	GTYRAC	1 cut(s)	127
HindII	GTYRAC	1 cut(s)	127
HphI	GGTGA	2 cut(s)	374, 380
Hpy166II	GTNNAC	1 cut(s)	127
Hpy188I	TCNGA	4 cut(s)	274, 319, 418, 460
Hpy188III	TCNNGA	1 cut(s)	280
Hpy8I	GTNNAC	1 cut(s)	127
HpyAV	CCTTC	1 cut(s)	540
HpyCH4III	ACNGT	1 cut(s)	362
HpyCH4IV	ACGT	2 cut(s)	148, 462
HpyCH4V	TGCA	6 cut(s)	83, 194, 356, 431, 479, 542
HpyF10VI	GCNNNNNNNGC	2 cut(s)	428, 437
HpyF3I	CTNAG	3 cut(s)	95, 374, 417
HpySE526I	ACGT	2 cut(s)	148, 462
Hsp92II	CATG	1 cut(s)	347
HspAI	GCGC	1 cut(s)	7
Kzo9I	GATC	4 cut(s)	91, 118, 274, 370
LpnPI	CCDG	3 cut(s)	293, 441, 503
Lsp1109I	GCAGC	1 cut(s)	299
LweI	GCATC	5 cut(s)	92, 315, 343, 427, 574
MaeI	CTAG	1 cut(s)	572
MaeII	ACGT	2 cut(s)	148, 462
MalI	GATC	4 cut(s)	93, 120, 276, 372
MboI	GATC	4 cut(s)	91, 118, 274, 370
MboII	GAAGA	2 cut(s)	331, 578
MflI	RGATCY	1 cut(s)	274
MhlI	GDGCHC	1 cut(s)	390
MlsI	TGGCCA	1 cut(s)	230
MluCI	AATT	6 cut(s)	14, 165, 179, 208, 423, 481
MluNI	TGGCCA	1 cut(s)	230
MnlI	CCTC	2 cut(s)	241, 412
Mox20I	TGGCCA	1 cut(s)	230
MscI	TGGCCA	1 cut(s)	230
MseI	TTAA	4 cut(s)	135, 153, 183, 252
Msp20I	TGGCCA	1 cut(s)	230
MwoI	GCNNNNNNNGC	2 cut(s)	428, 437
NdeII	GATC	4 cut(s)	91, 118, 274, 370
NlaIII	CATG	1 cut(s)	347
NlaIV	GGNNCC	2 cut(s)	46, 528
PkrI	GCNGC	1 cut(s)	289
PpuMI	RGGWCCY	1 cut(s)	527
Psp5II	RGGWCCY	1 cut(s)	527
PspN4I	GGNNCC	2 cut(s)	46, 528
PspPI	GGNCC	1 cut(s)	527
PspPPI	RGGWCCY	1 cut(s)	527
PstI	CTGCAG	1 cut(s)	433
PsuI	RGATCY	1 cut(s)	274
SaqAI	TTAA	4 cut(s)	135, 153, 183, 252
SatI	GCNGC	1 cut(s)	288
Sau3AI	GATC	4 cut(s)	91, 118, 274, 370
Sau96I	GGNCC	1 cut(s)	527
SduI	GDGCHC	1 cut(s)	390
SetI	ASST	8 cut(s)	58, 151, 201, 242, 252, 292, 465, 522
SfaNI	GCATC	5 cut(s)	92, 315, 343, 427, 574
SfcI	CTRYAG	1 cut(s)	429
SinI	GGWCC	1 cut(s)	527
Sse9I	AATT	6 cut(s)	14, 165, 179, 208, 423, 481
SsiI	CCGC	1 cut(s)	214
SspMI	CTAG	1 cut(s)	572
StyI	CCWWGG	1 cut(s)	75
TaaI	ACNGT	1 cut(s)	362
TaiI	ACGT	2 cut(s)	151, 465
TaqI	TCGA	1 cut(s)	435
TasI	AATT	6 cut(s)	14, 165, 179, 208, 423, 481
Tru1I	TTAA	4 cut(s)	135, 153, 183, 252
Tru9I	TTAA	4 cut(s)	135, 153, 183, 252
TscAI	CASTG	2 cut(s)	103, 598
TseI	GCWGC	1 cut(s)	287
TspDTI	ATGAA	1 cut(s)	522
TspRI	CASTG	2 cut(s)	103, 598
VpaK11BI	GGWCC	1 cut(s)	527
XapI	RAATTY	4 cut(s)	14, 179, 208, 481
XspI	CTAG	1 cut(s)	572

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.